ORFeome > hadha – XORFeome 2.0

hadha – XORFeome 2.0

General Information

Species: Xenopus tropicalis hydroxyacyl-Coenzyme A dehydrogenase/3-ketoacyl-Coenzyme A thiolase/enoyl-Coenzyme A hydratase (trifunctional protein), alpha subunit, mRNA (cDNA clone MGC:76057 IMAGE:5307382), complete cds
Gene Symbol: hadha
Gene ID: 394832
ORF gb_acc: MG132764
ORF ID: 10068

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC063202

Library Location

Plate ID: GDExt11001
Well Location: A12

EST Sequences

Clone: MGC:76057 IMAGE:5307382
Trimmed Sequence: ATGGCGGCTGCGCGGCTCGTTGGGGTTCTGGCCAGGCTCGGCGGGGCTAACAGGACAGGTTATACTTGCAGGCATCTCTCCATGTCATCAGCACTACTGACAAGAACCCACGTAAACTATGAGATCAAAGATGATGTTGCTGTTGTTCGATTTAACACCCCCAATTCCAAGGTGAACACACTGTCCAAGCAGCTGCAGACAGAATTCAGCGACGTTATGAATGAAATCTGGGCCAACGACGCCGTCCAAAGTGCCGTCCTAATCTCTTCCAAACCGGGCTGCTTCATCGCTGGGGCTGATATCAACATGATTGAGTCCTGTAAGACCAGCCAGGAAGTCACGCAGCTGTCCCAGGAAGGGCAGAAAATGTTTGCCAAGCTGGAGAAGTCCCCCAAACCCATAGTTGCTGCCATCAATGGTTCCTGCCTGGGAGGTGGATTAGAGGTGGCCATTGCCTGCCAGTACAGAGTGGCAACGAAGGACAAGAAGACTGTTCTGGGGACCCCAGAGGTTTTACTTGGGTTGCTGCCCGGGGCAGGAGGAACACAGAGGCTGCCCAGAATGGTGGGGCTTCCCACAGCGTTTGACATGATGCTGACTGGAAGAAACATCCGAGCCGACAGGGCAAAGAGAATGGGATTGGTGGATCAGCTTGTTGATCCTCTCGGACCAGGCCTGAAAAGTCCAGAGGATAGAACTATCGAGTACCTGGAAGAAGTAGCTGTGGACTGTGCCCGAGGAATAGCCAAGAAGAAGATCTCATTGAAGAAAGAGAAGGGTCTGATGCAGAAGGTCACAGACTATGTCATGTCCGTGCCGTTTGTCCGGCAACAAATCTACAAAACAGTGGAGAAAAAAGTGAATAAACAGACAAAGGGTCTTTACCCTGCCCCCTTGAAGATTATTGAGGTGGTAAGGACTGGGCTGGACCAGGGACAGGAGGCTGGCTATCTGGCCGAGGCACAGAAATTCGGGGAGCTGGGAACGACCCCAGAGTCCAAAGCACTAATCGGGCTGTACCACGGACAGGTTATTTGTAAGAAGAATAAGTTTGGCACTCCAGAAAGACCAGTACAGAAATTGGCTATACTTGGGGCTGGCCTTATGGGAGCTGGCATTGCTCAGGTCTCTGTGGATAAAGGGTTAAAGACCATTCTGAAGGACACGACAGTGGAAGGCTTAGGAAGAGGGCAACAACAAGTCTACAAAGGGCTTAATGACAAGGTGAAGAAGAAGAGTCTGACTTCGTTTGAGAGAGACAGCATTGTCAGCAACCTGACGGGGCAGCTGGATTATAAGGGTTTCGAGACAGCCGACATGGTGATCGAGGCCGTGTTTGAGGATATCCGCATTAAACACAAAGTTCTACAGGAGGTGGAAGCTGTTGTCCCCCCACACTGTATATTTGCCAGCAACACGTCGGCCCTCCCCATCTCTCAGATAGCAGCCGCCAGCAAAAGGCCAGAAAAAGTGATCGGGATGCACTATTTCTCCCCTGTGGATAAGATGCAGCTGCTGGAAATAATCACTACTGACAAAACCTCTAAGGACACCACCGCTGCCGCTGTCGCTGTCGGCCTCAAGCAGGGCAAGGTGATCATTGTGGTAAAGGACGGGCCAGGATTCTACACTACCCGCTGCCTTGGTCCCATGATGGCTGAAGTTGTCCGTGTCCTGCAGGAAGGGGTAGATCCCAAGAAACTGGATGCCCTCTCTACCGGCTTTGGTTTCCCAGTAGGGGCATCTACTCTAGCTGACGAGGTGGGCATCGACGTGGCGGCTCACGTGGCTGAGGACCTTGGCAAAGCTTTCGGAGAGCGCTTCGGGGGCGGGAACATTGAGCTCTTGAAAGCTATGGTGGCCAAAGGATTCTTGGGGCGTAAATCAGGAAAAGGCTTTTACATTTATCAGCAGGGAGTGAAGAACCGGTCCATTAACTCTGGCACTGAGGAGATACTGGAGAAGTTCAAGCTACAGGCCAAGCCTGAAGTCTCCTCCAATGAAGACATCCAGTTGCGCTTGGTCACTCGCTTTGTGAATGAGGCAGTGATGTGCCTGCAGGAGGGAATCCTCGCTAACCCAGTAGAGGGAGACATTGGGGCTGTGTTTGGCCTTGGGTTCCCCCCATGTCTGGGCGGCCCATTCAGGTACGCCGACGCCTTCGGAGCAAAGCGCATAGTGGAGAAGATGCGCAAGTACGAGAGTGTGTACGGCAGCCAGTTCACCCCGTGCCAGCTGCTGCTCGACCACGCCAGCGACCCCAGCAAGAAGTTCCACCATTAA
Full Trace Sequence: ggacaagatggcggctgcgcggctcgttggggttctggccaggctcggcggggctaacaggacaggttatacttgcaggcatctctccatgtcatcagcactactgacaagaacccacgtaaactatgagatcaaagatgatgttgctgttgttcgatttaacacccccaattccaaggtgaacacactgtccaagcagctgcagacagaattcagcgacgttatgaatgaaatctgggccaacgacgccgtccaaagtgccgtcctaatctcttccaaaccgggctgcttcatcgctggggctgatatcaacatgattgagtcctgtaagaccagccaggaagtcacgcagctgtcccaggaagggcagaaaatgtttgccaagctggagaagtcccccaaacccatagttgctgccatcaatggttcctgcctgggaggtggattagaggtggccattgcctgccagtacagagtggcaacgaaggacaagaagactgttctggggaccccagaggttttacttgggttgctgcccggggcaggaggaacacagaggctgcccagaatggtggggcttcccacagcgtttgacatgatgctgactggaagaaacatccgagccgacagggcaaagagaatgggattggtggatcagcttgttgatcctctcggaccaggcctgaaaagtccagaggatagaactatcgagtacctggaagaagtagctgtggactgtgcccgaggaatagccaagaagaagatctcattgaagaaagagaagggtctgatgcagaaggtcacagactatgtcatgtccgtgccgtttgtccggcaacaaatctacaaaacagtggagaaaaaagtgaataaacagacaaagggtctttaccctgcccccttgaagattattgaggtggtaaggactgggctggaccagggacaggaggctggctatctggccgaggcacagaaattcggggagctgggaacgaccccagagtccaaagcactaatcgggctgtaccacggacaggttatttgtaagaagaataagtttggcactccagaaagaccagtacagaaattggctatacttggggctggccttatgggagctggcattgctcaggtctctgtggataaagggttaaagaccattctgaaggacacgacagtggaaggcttaggaagagggcaacaacaagtctacaaagggcttaatgacaaggtgaagaagaagagtctgacttcgtttgagagagacagcattgtcagcaacctgacggggcagctggattataagggtttcgagacagccgacatggtgatcgaggccgtgtttgaggatatccgcattaaacacaaagttctacaggaggtggaagctgttgtccccccacactgtatatttgccagcaacacgtcggccctccccatctctcagatagcagccgccagcaaaaggccagaaaaagtgatcgggatgcactatttctcccctgtggataagatgcagctgctggaaataatcactactgacaaaacctctaaggacaccaccgctgccgctgtcgctgtcggcctcaagcagggcaaggtgatcattgtggtaaaggacgggccaggattctacactacccgctgccttggtcccatgatggctgaagttgtccgtgtcctgcaggaaggggtagatcccaagaaactggatgccctctctaccggctttggtttcccagtaggggcatctactctagctgacgaggtgggcatcgacgtggcggctcacgtggctgaggaccttggcaaagctttcggagagcgcttcgggggcgggaacattgagctcttgaaagctatggtggccaaaggattcttggggcgtaaatcaggaaaaggcttttacatttatcagcagggagtgaagaaccggtccattaactctggcactgaggagatactggagaagttcaagctacaggccaagcctgaagtctcctccaatgaagacatccagttgcgcttggtcactcgctttgtgaatgaggcagtgatgtgcctgcaggagggaatcctcgctaacccagtagagggagacattggggctgtgtttggccttgggttccccccatgtctgggcggcccattcaggtacgccgacgccttcggagcaaagcgcatagtggagaagatgcgcaagtacgagagtgtgtacggcagccagttcaccccgtgccagctgctgctcgaccacgccagcgaccccagcaagaagttccaccattaaaccactaactctccctgctcctaaggaagcggctgtgaggaaccgagcgcagtgtccccggaggagaatgaaggtgttaaagtgtggtgcactaacgcagagaatactgcccctaaccctgatgagcgattgtagccatacgtgccttagattgaacgccactcgggcacttgcgctccacccagttaagcttttccgtatggctggtatttgcacttacgtctggctcagagacattttatctgattcgccagtatgggggggaggtccctgtctatgtgggaggtccgcccactttgctggcagtgaagccattccattgcaatgtggacttgatcaataaaatatccttttaaaaaaaaaaaaaaaaaaaa
Translation: MAAARLVGVLARLGGANRTGYTCRHLSMSSALLTRTHVNYEIKDDVAVVRFNTPNSKVNTLSKQLQTEFSDVMNEIWANDAVQSAVLISSKPGCFIAGADINMIESCKTSQEVTQLSQEGQKMFAKLEKSPKPIVAAINGSCLGGGLEVAIACQYRVATKDKKTVLGTPEVLLGLLPGAGGTQRLPRMVGLPTAFDMMLTGRNIRADRAKRMGLVDQLVDPLGPGLKSPEDRTIEYLEEVAVDCARGIAKKKISLKKEKGLMQKVTDYVMSVPFVRQQIYKTVEKKVNKQTKGLYPAPLKIIEVVRTGLDQGQEAGYLAEAQKFGELGTTPESKALIGLYHGQVICKKNKFGTPERPVQKLAILGAGLMGAGIAQVSVDKGLKTILKDTTVEGLGRGQQQVYKGLNDKVKKKSLTSFERDSIVSNLTGQLDYKGFETADMVIEAVFEDIRIKHKVLQEVEAVVPPHCIFASNTSALPISQIAAASKRPEKVIGMHYFSPVDKMQLLEIITTDKTSKDTTAAAVAVGLKQGKVIIVVKDGPGFYTTRCLGPMMAEVVRVLQEGVDPKKLDALSTGFGFPVGASTLADEVGIDVAAHVAEDLGKAFGERFGGGNIELLKAMVAKGFLGRKSGKGFYIYQQGVKNRSINSGTEEILEKFKLQAKPEVSSNEDIQLRLVTRFVNEAVMCLQEGILANPVEGDIGAVFGLGFPPCLGGPFRYADAFGAKRIVEKMRKYESVYGSQFTPCQLLLDHASDPSKKFHH
Donor tissue: gastrula