ORFeome > hcap-g – XORFeome 2.0

hcap-g – XORFeome 2.0

General Information

Species: Xenopus tropicalis chromosome condensation protein G, mRNA (cDNA clone MGC:76110 IMAGE:5308689), complete cds
Gene Symbol: hcap-g
Gene ID: 394798
ORF gb_acc:
ORF ID: 10024

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC063208

Library Location

Plate ID: GDExt11001
Well Location: B04

EST Sequences

Clone: MGC:76110 IMAGE:5308689
Trimmed Sequence: ATGGTCACAGACGGGAAAGCCATGCAGATAAAAGAGGCGTTTGATTTGTCTCAGAAGGCGCACCAGAACCATGCCAAGCTGGTCTCCTCACTGCGAGCAGCCTATAATAAGATGGAAGACAAATCCATTTTCTTGGAAGAGTTTGTTCACTTCCTCAAGTACCCTCTCATAGTGTACCGGAGAGAGCCCGCTGTGGAGAGAGTCATGGACTTTGTGGCCAAGTTTGTCACCTCTTTCCACAATTCTGATGGTGAAGATGAGGATGAAGTGGATGAAGAAAACTCGCCTGTTAATTATTTGTTTAATTTTCTACTGCAGTCCCATGGTGCCAACAGTATGGCTGTGAGGTTTAGAGTTTGCCAGCTAATTAATAAACTACTGGTGAACCTTCCAGAAAATGCCCAAATTGACGATGACTTATTTGATAAGATCCATGATGCCATGCTAATACGTCTGAAAGACAGAGTGCCAAACGTGCGCATACAGGCAGTTCTGGCATTAGCCCGGCTTCAGGACCCCAGTGACCCAGACTGCCCAGTTTGTAATGCGTATATGCACTTGCTGGAGAATGATTCCAACCCAGAGGTACGGAGAGCGGTGCTAACCTGCATTGCCCCTTCAGCAAGATCCCTGCCAAAAATTGTCGGTCGCACAATGGATGTGAAGGAGCCTGTTAGGAAGCTGGCGTTTCAGGTTTTATCGGAAAAGGTTCACATCAGGGCCTTAACCATTGCCCAGAGAGTCAAACTTCTGCAGCAAGGGCTGAATGACAGATCAGCTGCAGTGAAAGACGTTATGCAGAAGAAGCTTATTCAGGCTTGGCTCCGATATTCAGAGGGTGATGTGTTGGATTTGCTCCATCGTTTGGATGTGGAGAATTCCCCAGATGTTGCATTATCTGCTCTTAATGCCTTGTTCTCCGTGTCGCCAGTCAGTGAGCTGGTTCAGAACTGCAAAAACCTGGATGAGAGAAAATTGATCCCAGTTGAGACCCTTACTCCAGAGAATGTGCTCTACTGGCGAGCACTGTGTGAGCACCTAAAGTCCAAGGGTGATGAAGGAGAAGCAGCACTAGAAAATATCTTGCCAGAGCCTGCTGTGTACGCCAGTTATTTGTCAAGTTATCTTCAGACCTTGCCGGTTCTGACAGAAGAACAAAGAGCGGATATGACTAAAATTGAAGACTTGATGACTAGAGAGTTTATTGGGCAGCAGTTGATTCTCACAATAGGCTGCCTGGATACCAGCGAGGAAGGAGGCAGGAAACGCCTCCTTGCTGTTCTGCAAGAGATCCTTGTTATACAGAACACCGCAACGTCTTTGATTTCCTCCTTGGCAGAATTGTTGCTCCGTATTCTTAAAGATGATGACAAGCGAACTCAAACCGTTGCAGAAATCATCTCTGAGCTGCGAGAGCCAATTGTCACCGTGGACAACCCAAGAGATGTTGCTGAATCCAGGAAGTTACAATTGAAGCTTGCCGATGTGAAAGTGCAGCTCATTGAAGCCAAGCAGGCTCTGGAGGACAGCTTAACTATGGAAGATTACAGTCGGGCCTCTGAATTAAAGGAGAAAGTGAAGGAGCTGGAAAGCCTGAAAGCTCAGCTGACTAAAGAAGCCGAGGAGCCAGAAATTAAGGAGATCCGTGTGGAGAAGAATGACCCAGAAACACTCCTGAAATGCCTGATTATGTGTAATGAACTTCTCAAGCACCTGTCCCTTTCCAAAGGACTAGGGGGAACTATAAACGAAATTATTGAATCTCTGATTCTTCCTGGCATAACCAACGTTCACCCCTCTGTTCGGAATATGGCAGTGCTGAGCATTGGCTGCTGTGCTCTGCAGAATAAAGGCTTTGCAAGGCAACACCTCCCACTGTTATTACAAATTTCCCAGCTGGATGAGGTGAAAGTCAAGATCAGTGCCCTGAGCGCAGTGTTTGATATGCTTCTGCTCTTTGGCCTGGACATTCTCAAATCCAAGCCCTCCAATCCTGATGATTCCCAGTGCAAAGCTCAGGAGAATGCAGATGAGGAGATTTCTGAGGAGGAAAAGCCGGACACGGTAGATGAGACGCTGACTAATGAAGAAGTCAAAGAAGAAACTGCTACTGTTAATGGCATCCTGCAACTGTTCTCTCGCTTCTTGGACAGTGAGATTCCAGAAATAAGGACAGAGACAGCGGAAGGCTTGGCCAAGCTGATGTTCTCTGGAAGGTTAATAAGTGCCAAACTGCTCTCACGTTTGATTTTGCTGTGGTACAATCCCGTCACGGAGGAGGATACAAAGCTTCGACATTGCCTGGGTGTTTTCTTTCCCATTTTTGCATATTCTTGCAGGTCAAACCAAGAATGTTTTGAAGAAACTTTCTTCCCCACTTTACAGACTCTCTTTAATGCCCCGTCGAGTTCTCCTTTAGCCGATGTCGACGTTGCTAATGTCGCAGAATTGCTTGTGGATCTTACCAGACCCAGTGGGTTGAACCCACAGAACAAACAGCCACAGGACTATAAGGCTGCTACAGTGCACGATAGCTTGGCTATAAAAATTTGCCATGAAATATTGAAAGATCCCAAAGCTCCAGATGTTCGTATCTACGCCAAAGCTTTGTGTTCTCTAGAGCTTTCCAGAGAAAATGCGCAAGAGCTGCTGCCACTATTGGATTGTGCTGCGGAGGATGTTACTGACAAGGTCTGTGAAAGAGCAATAGAAAAAGTCAGGGCTCAGTTAAGAAGCGGTAGAGAAGAACACCAGGTATCTAAGGAAACAGAACCTCAGGTATCTAAGGAAACAGAACCCCAGGTGTCTAAGGAAACAGCAGACGGCACCAATTTGCAAGAAAATGAAGAAGGAAAACAAAAAGACGAGGCTCAGTGTGACGAGAACACAGACTTGGCAAAAGAGAAGGCAGCAAAAGGAAAACCTACTAAAGGGCGGAGAAAGGCTCCTACTGCAGCAAATCGTAGGAAAGCCAGTAAAGCGGAAGAGGCAGACGGTGAAAGAGAGCGGCAGGAAGAGGCACAGGCTGTTGCCGTCAATACGCGGCCATCGAGGAGAGCAAAAACCGCAGCCATGGAAAAAACAAAGATGAATCTCTCAAAGTTGCTGAATGAGGAAGCAAATTAA
Full Trace Sequence: ggcgagttgttccgctaatatacactgggagccgggtgataatccccgcttgtgcgatactggtaacagcggcccaaacatggtcacagacgggaaagccatgcagataaaagaggcgtttgatttgtctcagaaggcgcaccagaaccatgccaagctggtctcctcactgcgagcagcctataataagatggaagacaaatccattttcttggaagagtttgttcacttcctcaagtaccctctcatagtgtaccggagagagcccgctgtggagagagtcatggactttgtggccaagtttgtcacctctttccacaattctgatggtgaagatgaggatgaagtggatgaagaaaactcgcctgttaattatttgtttaattttctactgcagtcccatggtgccaacagtatggctgtgaggtttagagtttgccagctaattaataaactactggtgaaccttccagaaaatgcccaaattgacgatgacttatttgataagatccatgatgccatgctaatacgtctgaaagacagagtgccaaacgtgcgcatacaggcagttctggcattagcccggcttcaggaccccagtgacccagactgcccagtttgtaatgcgtatatgcacttgctggagaatgattccaacccagaggtacggagagcggtgctaacctgcattgccccttcagcaagatccctgccaaaaattgtcggtcgcacaatggatgtgaaggagcctgttaggaagctggcgtttcaggttttatcggaaaaggttcacatcagggccttaaccattgcccagagagtcaaacttctgcagcaagggctgaatgacagatcagctgcagtgaaagacgttatgcagaagaagcttattcaggcttggctccgatattcagagggtgatgtgttggatttgctccatcgtttggatgtggagaattccccagatgttgcattatctgctcttaatgccttgttctccgtgtcgccagtcagtgagctggttcagaactgcaaaaacctggatgagagaaaattgatcccagttgagacccttactccagagaatgtgctctactggcgagcactgtgtgagcacctaaagtccaagggtgatgaaggagaagcagcactagaaaatatcttgccagagcctgctgtgtacgccagttatttgtcaagttatcttcagaccttgccggttctgacagaagaacaaagagcggatatgactaaaattgaagacttgatgactagagagtttattgggcagcagttgattctcacaataggctgcctggataccagcgaggaaggaggcaggaaacgcctccttgctgttctgcaagagatccttgttatacagaacaccgcaacgtctttgatttcctccttggcagaattgttgctccgtattcttaaagatgatgacaagcgaactcaaaccgttgcagaaatcatctctgagctgcgagagccaattgtcaccgtggacaacccaagagatgttgctgaatccaggaagttacaattgaagcttgccgatgtgaaagtgcagctcattgaagccaagcaggctctggaggacagcttaactatggaagattacagtcgggcctctgaattaaaggagaaagtgaaggagctggaaagcctgaaagctcagctgactaaagaagccgaggagccagaaattaaggagatccgtgtggagaagaatgacccagaaacactcctgaaatgcctgattatgtgtaatgaacttctcaagcacctgtccctttccaaaggactagggggaactataaacgaaattattgaatctctgattcttcctggcataaccaacgttcacccctctgttcggaatatggcagtgctgagcattggctgctgtgctctgcagaataaaggctttgcaaggcaacacctcccactgttattacaaatttcccagctggatgaggtgaaagtcaagatcagtgccctgagcgcagtgtttgatatgcttctgctctttggcctggacattctcaaatccaagccctccaatcctgatgattcccagtgcaaagctcaggagaatgcagatgaggagatttctgaggaggaaaagccggacacggtagatgagacgctgactaatgaagaagtcaaagaagaaactgctactgttaatggcatcctgcaactgttctctcgcttcttggacagtgagattccagaaataaggacagagacagcggaaggcttggccaagctgatgttctctggaaggttaataagtgccaaactgctctcacgtttgattttgctgtggtacaatcccgtcacggaggaggatacaaagcttcgacattgcctgggtgttttctttcccatttttgcatattcttgcaggtcaaaccaagaatgttttgaagaaactttcttccccactttacagactctctttaatgccccgtcgagttctcctttagccgatgtcgacgttgctaatgtcgcagaattgcttgtggatcttaccagacccagtgggttgaacccacagaacaaacagccacaggactataaggctgctacagtgcacgatagcttggctataaaaatttgccatgaaatattgaaagatcccaaagctccagatgttcgtatctacgccaaagctttgtgttctctagagctttccagagaaaatgcgcaagagctgctgccactattggattgtgctgcggaggatgttactgacaaggtctgtgaaagagcaatagaaaaagtcagggctcagttaagaagcggtagagaagaacaccaggtatctaaggaaacagaacctcaggtatctaaggaaacagaaccccaggtgtctaaggaaacagcagacggcaccaatttgcaagaaaatgaagaaggaaaacaaaaagacgaggctcagtgtgacgagaacacagacttggcaaaagagaaggcagcaaaaggaaaacctactaaagggcggagaaaggctcctactgcagcaaatcgtaggaaagccagtaaagcggaagaggcagacggtgaaagagagcggcaggaagaggcacaggctgttgccgtcaatacgcggccatcgaggagagcaaaaaccgcagccatggaaaaaacaaagatgaatctctcaaagttgctgaatgaggaagcaaattaaaatgtcattagttgtgatctgtaggcagaattgcgctgtagcgtcacttgtgcgtgatgattggtctccatctatcctgcgccctggtacatgggcccttcagccttgtctgcttgctgatttggacactggatgcccggcacagtgctgggtcattttgtttattctgaactcattacagattttctctgctgtttgttacagatgtcggctcccggcttttactgctctgattggatattgaggtttagctgaggggttgggggaggggcaattggtatttgagaagcttaacagcttccttgtccatacaaaacctaataaacattctggaagtttttcttacccaaacccgataaggaaataaattttgcaaaaaagaaaaaaaaaaaaaaaa
Translation: MVTDGKAMQIKEAFDLSQKAHQNHAKLVSSLRAAYNKMEDKSIFLEEFVHFLKYPLIVYRREPAVERVMDFVAKFVTSFHNSDGEDEDEVDEENSPVNYLFNFLLQSHGANSMAVRFRVCQLINKLLVNLPENAQIDDDLFDKIHDAMLIRLKDRVPNVRIQAVLALARLQDPSDPDCPVCNAYMHLLENDSNPEVRRAVLTCIAPSARSLPKIVGRTMDVKEPVRKLAFQVLSEKVHIRALTIAQRVKLLQQGLNDRSAAVKDVMQKKLIQAWLRYSEGDVLDLLHRLDVENSPDVALSALNALFSVSPVSELVQNCKNLDERKLIPVETLTPENVLYWRALCEHLKSKGDEGEAALENILPEPAVYASYLSSYLQTLPVLTEEQRADMTKIEDLMTREFIGQQLILTIGCLDTSEEGGRKRLLAVLQEILVIQNTATSLISSLAELLLRILKDDDKRTQTVAEIISELREPIVTVDNPRDVAESRKLQLKLADVKVQLIEAKQALEDSLTMEDYSRASELKEKVKELESLKAQLTKEAEEPEIKEIRVEKNDPETLLKCLIMCNELLKHLSLSKGLGGTINEIIESLILPGITNVHPSVRNMAVLSIGCCALQNKGFARQHLPLLLQISQLDEVKVKISALSAVFDMLLLFGLDILKSKPSNPDDSQCKAQENADEEISEEEKPDTVDETLTNEEVKEETATVNGILQLFSRFLDSEIPEIRTETAEGLAKLMFSGRLISAKLLSRLILLWYNPVTEEDTKLRHCLGVFFPIFAYSCRSNQECFEETFFPTLQTLFNAPSSSPLADVDVANVAELLVDLTRPSGLNPQNKQPQDYKAATVHDSLAIKICHEILKDPKAPDVRIYAKALCSLELSRENAQELLPLLDCAAEDVTDKVCERAIEKVRAQLRSGREEHQVSKETEPQVSKETEPQVSKETADGTNLQENEEGKQKDEAQCDENTDLAKEKAAKGKPTKGRRKAPTAANRRKASKAEEADGERERQEEAQAVAVNTRPSRRAKTAAMEKTKMNLSKLLNEEAN
Donor tissue: gastrula