ORFeome > hif1a – XORFeome 2.0

hif1a – XORFeome 2.0

General Information

Species: Xenopus tropicalis hypoxia-inducible factor 1, alpha subunit (basic helix-loop-helix transcription factor), mRNA (cDNA clone MGC:89276 IMAGE:6977286), complete cds
Gene Symbol: hif1a
Gene ID: 496583
ORF gb_acc: MG134365
ORF ID: 12052

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC084989

Library Location

Plate ID: GDExt11019
Well Location: D12

EST Sequences

Clone: MGC:89276 IMAGE:6977286
Trimmed Sequence: ATGGAGGGATCTGTAGTAGCGAGCGACAAGAAAAGAATTAGCTCAGAGCGCCGTAAAGAGAAATCACGTGATGCTGCCAGATGTCGGAGGAGTAAGGAGTCGGAGGTCTTTTATGAGCTATCACACGAGTTGCCTTTACCGCACAATGTCAGCTCGCATCTTGACAAGGCCTCTATCATGAGGCTCACCATTAGTTACCTGCGGATAAGAAGGTTGCTTGACGCAGGAGATTTGGATGGTGAGACCGAGTTGGACAAGCAACTCAATTGTTTCTATTTGAAGGCACTGGAAGGGTTTGTCTTGGTTCTTACTGAAGAGGGGGATATGATTTATCTATCTGAAAATGTCAACAAGTGCATGGGCCTCACACAGTTTGAGCTTACTGGACACAGCGTGTTTGATTTCACTCATCCTTGCGATCATGAAGAGCTAAGGGAGATGCTAACTTTCAGAAATGGGCCTGCAAAAAAAGGAAAAGAACAAATCACAGAAAGGAGTTTCTTTCTTCGTATGAAGTGCACCTTAACCAGTCGGGGAAGAACAGTGAATATAAAGTCAGCCACGTGGAAGGTACTTCACTGTACAGGACACATGCGTGTATATGATGCAAACAACCATAACCATTGTGGCTACAAGAAGCCTCCCATGACATGCATGGTTATAATCTGTGAACCAATTCCTCATCCATCAAATATTGAGTTCCCCTTGGACAGCAAGACCTTTCTTAGTCGCCACAGCCTTGACATGAAGTTTTCCTATTGTGATGAAAGGGTAACTGAATTAGTAGGATATGAACCAGATGAACTTTTGGGGCGTTCTGTCTATGAATATTATCATGCCTTGGACTCTGATCATTTGACCAAAGCTCACCATAATATGTTCACAAAGGGACAGGTGACTACTGGACAGTACAGAATGCTTGCAAAAAAAGGTGGTTATGTCTGGGTGGAAACACAAGCAACTCCAATAAAAATTCCTTCAATCTAA
Full Trace Sequence: ccgggagaaaaaaaagaaacaccgcgatcgtacggtcggattgagcggagggattgcgtcaaaaaagagttcctgccggtgttgtcggggtctgaccttgcgagcgcctcacgcctgtggattacaatagccctttcagtagggccctcggtttctgcgtgcataggacaaaaccctcggcgcttgacacagctccggagcgtccctcccccactcgcttggcatggagggatctgtagtagcgagcgacaagaaaagaattagctcagagcgccgtaaagagaaatcacgtgatgctgccagatgtcggaggagtaaggagtcggaggtcttttatgagctatcacacgagttgcctttaccgcacaatgtcagctcgcatcttgacaaggcctctatcatgaggctcaccattagttacctgcggataagaaggttgcttgacgcaggagatttggatggtgagaccgagttggacaagcaactcaattgtttctatttgaaggcactggaagggtttgtcttggttcttactgaagagggggatatgatttatctatctgaaaatgtcaacaagtgcatgggcctcacacagtttgagcttactggacacagcgtgtttgatttcactcatccttgcgatcatgaagagctaagggagatgctaactttcagaaatgggcctgcaaaaaaaggaaaagaacaaatcacagaaaggagtttctttcttcgtatgaagtgcaccttaaccagtcggggaagaacagtgaatataaagtcagccacgtggaaggtacttcactgtacaggacacatgcgtgtatatgatgcaaacaaccataaccattgtggctacaagaagcctcccatgacatgcatggttataatctgtgaaccaattcctcatccatcaaatattgagttccccttggacagcaagacctttcttagtcgccacagccttgacatgaagttttcctattgtgatgaaagggtaactgaattagtaggatatgaaccagatgaacttttggggcgttctgtctatgaatattatcatgccttggactctgatcatttgaccaaagctcaccataatatgttcacaaagggacaggtgactactggacagtacagaatgcttgcaaaaaaaggtggttatgtctgggtggaaacacaagcaactccaataaaaattccttcaatctaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MEGSVVASDKKRISSERRKEKSRDAARCRRSKESEVFYELSHELPLPHNVSSHLDKASIMRLTISYLRIRRLLDAGDLDGETELDKQLNCFYLKALEGFVLVLTEEGDMIYLSENVNKCMGLTQFELTGHSVFDFTHPCDHEELREMLTFRNGPAKKGKEQITERSFFLRMKCTLTSRGRTVNIKSATWKVLHCTGHMRVYDANNHNHCGYKKPPMTCMVIICEPIPHPSNIEFPLDSKTFLSRHSLDMKFSYCDERVTELVGYEPDELLGRSVYEYYHALDSDHLTKAHHNMFTKGQVTTGQYRMLAKKGGYVWVETQATPIKIPSI
Donor tissue: tailbud