ORFeome > hif1an – XORFeome 2.0

hif1an – XORFeome 2.0

General Information

Species: Xenopus tropicalis hypoxia-inducible factor 1, alpha subunit inhibitor, mRNA (cDNA clone MGC:76135 IMAGE:5309371), complete cds
Gene Symbol: hif1an
Gene ID: 394511
ORF gb_acc: MG132739
ORF ID: 10039

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC061609

Library Location

Plate ID: GDExt11001
Well Location: A07

EST Sequences

Clone: MGC:76135 IMAGE:5309371
Trimmed Sequence: ATGGCGGAGGCTGGGGTTTCGGCGGCGGAGGCTGTGGCAGAGACAGAGAGACAAGGGGGTGGGGAAGCTGAGCTCCGCTGTCCTGGCTGGAGTGAGTCGCAGCTGCGGTCTTACCAATTTCAGACGCGACAGATTCCGCGACTACAACACGGAGACCCCCGGGCAGAGGAGCTCATCGATAAGGAGGAGCCAGTTGTTCTGACAGATACAAACTTAGTACATACAGCACTGAAGTGGGATTTGGATTATCTGGAGGAAAACATTGGAAATGGGGACTTTTCTGTGTACAGTGCCAACAGCCACAAGTTTCTATATTATGATGAGAAGAAAATGGTTAACTTCAAGAACTTTAAGCCCAAGTCCAGCAGGGAGGAAATGAAATTTCCAGAGTTTGTAAATAAACTTAAAGACATACAAGAGAGAGAGAGCGATGAAAGGTTATATCTACAGCAAACACTGAATGACACAGTGGGCAGAAAAATTGTGGTGGATTTCTTGGGCTTTAACTGGAACTGGATTAATAAACAGCAAGCCAAACATGGATGGGGACAGTTGACTTCTAATTTACTTCTGATTGGCATGGAAGGGAATGTGACACCGGCACACTATGATGAGCAGCAAAATTTCTTTGCCCAGATTAAGGGATACAAACGGTGTATCCTCTTTCCTCCTGAACAGTTTGAATGTCTCTATCCATATCCTGTCCACCATCCATGTGACAGACAGAGCCAGGTTGATTTTGAAAATCCTGATTTTGAAAGGTTCCCCAACTTCAGGAATGTTCTTGGCTATGAGACAGTTGTGGGGCCTGGAGATGTTCTGTATATTCCAATGTACTGGTGGCACCACATTGAATCACTGATGGATGGAGGGATCACTATTACTGTTAATTTCTGGTACAAGGGTGCCCCAACTCCGAAAAGAATAGAATATCCTCTCAAAGCACATCAAAAGGTGGCAATAATGAGAAATATTGAAAAAATGCTTGGAGAGGCCCTTGGAAATCCACAAGAGGTTGGTCCACTGTTAAATACAATGGTAAAGGGTCGCTACGACTGA
Full Trace Sequence: gccggcctgggcatggcggaggctggggtttcggcggcggaggctgtggcagagacagagagacaagggggtggggaagctgagctccgctgtcctggctggagtgagtcgcagctgcggtcttaccaatttcagacgcgacagattccgcgactacaacacggagacccccgggcagaggagctcatcgataaggaggagccagttgttctgacagatacaaacttagtacatacagcactgaagtgggatttggattatctggaggaaaacattggaaatggggacttttctgtgtacagtgccaacagccacaagtttctatattatgatgagaagaaaatggttaacttcaagaactttaagcccaagtccagcagggaggaaatgaaatttccagagtttgtaaataaacttaaagacatacaagagagagagagcgatgaaaggttatatctacagcaaacactgaatgacacagtgggcagaaaaattgtggtggatttcttgggctttaactggaactggattaataaacagcaagccaaacatggatggggacagttgacttctaatttacttctgattggcatggaagggaatgtgacaccggcacactatgatgagcagcaaaatttctttgcccagattaagggatacaaacggtgtatcctctttcctcctgaacagtttgaatgtctctatccatatcctgtccaccatccatgtgacagacagagccaggttgattttgaaaatcctgattttgaaaggttccccaacttcaggaatgttcttggctatgagacagttgtggggcctggagatgttctgtatattccaatgtactggtggcaccacattgaatcactgatggatggagggatcactattactgttaatttctggtacaagggtgccccaactccgaaaagaatagaatatcctctcaaagcacatcaaaaggtggcaataatgagaaatattgaaaaaatgcttggagaggcccttggaaatccacaagaggttggtccactgttaaatacaatggtaaagggtcgctacgactgatgcaactgaacggtgacaatgggtggcatcgatgtcactgcagctttatatgtgggtaaatgaggaaaatgaaagatatattctttctcacttgctctgactggtttccgatacctttggtttacaccacttaattactactgtatttatactctctttggatgctgatgaagaaagaaataaaatcaacaaaataattaaaaaaaaaaaaaaaaaaaaaaa
Translation: MAEAGVSAAEAVAETERQGGGEAELRCPGWSESQLRSYQFQTRQIPRLQHGDPRAEELIDKEEPVVLTDTNLVHTALKWDLDYLEENIGNGDFSVYSANSHKFLYYDEKKMVNFKNFKPKSSREEMKFPEFVNKLKDIQERESDERLYLQQTLNDTVGRKIVVDFLGFNWNWINKQQAKHGWGQLTSNLLLIGMEGNVTPAHYDEQQNFFAQIKGYKRCILFPPEQFECLYPYPVHHPCDRQSQVDFENPDFERFPNFRNVLGYETVVGPGDVLYIPMYWWHHIESLMDGGITITVNFWYKGAPTPKRIEYPLKAHQKVAIMRNIEKMLGEALGNPQEVGPLLNTMVKGRYD
Donor tissue: gastrula