ORFeome > hps1 – XORFeome 2.0

hps1 – XORFeome 2.0

General Information

Species: Xenopus tropicalis Hermansky-Pudlak syndrome 1, mRNA (cDNA clone MGC:79480 IMAGE:6976532), complete cds
Gene Symbol: hps1
Gene ID: 448750
ORF gb_acc: MG133564
ORF ID: 11095

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC075098

Library Location

Plate ID: GDExt11010
Well Location: H10

EST Sequences

Clone: MGC:79480 IMAGE:6976532
Trimmed Sequence: ATGAAATGTGTACTTATTGCCTCCGAGGGAGCTGAAGTCCTGTTCTACTGGGCAGATGAAGAGTTTGAGAAGAACCTGCAGAGCAAATATGATTATACTGAGGAACAGCAGCCACCAAACTATGGAGACAGCATTAATACTCTTTTCGCTCCTTTAATCATCTCTTGTGTTACAATAATGGAGAAGATTAATGATACCTATACATGTTTCACCACTGAAAAAGGTCACCTCTGCGTCCTTCACATGTTTGGAGAATGCCTCTACATTGCAGTAAATGGTGATGAAACTGAAAACGAGGACGACCTGCGCAGGAAATTGTATGTCCTTAAGAGACTCTGTGAGGTGCATTTTGGTCTGGTCACGTTTGACAGCCATTTGATTAAGAAGGAACTGCGCCCTGCAGATTCTGAACAGCGCAATCTAGTATGGAAGACCTTTCAGAGCTTGCTTCTGACATACAGTCGACTGCGAAATGAGGACCAGAGCTTTGCTGTTGAGGCAGTGGAGCGCCTGATTCACCCAAAGCTCTGTGAGCAGTGCATCGAGTTCCTGGAGAAACAGATTGTCCATTTCATTAACAGCAGCAGTGAGCGGGGGGCAGAGGAGGTCCTGCATGCTTTTGTACTGGTCAACACAAAACTTCTGGCTCTTTTCTCAAGTCGAAACGCCAGTTCTTTGAGACCTGCAGATCTACTCTCCTTAATTCTCATAGTTCAGGATTTGTATCCCAACTTCAGTACTCAAGAGCGAAATGTGGAGGAGAATGAAGACAATGCGCCTTCAGAGGAGTATTACACCCCAGATCCATCGCCCAATAACAGGAGTTTAAGTGGTGGCAGCTGGGTGGATGATGATTCCCCTGCACTTAGTTATGTTGATCCTGAAATCCAGATTGCTGAAGACAGTTTGAAAACCCTTGTGGGAGACATCCCTGAATCTACTAACACAAGAAGAGTTTTTTTGGATGCAACCCTAAAAGAAGGCTATTGTCCCATGATGCCACATTCCATGTACTGCTTACCACTTTGGCCGGGAATATCCCTGGTCCTGCTGACTAAGTTGTCAGGCAGCCATATTGCCCTCTCTCTGTATCAGCTCCTAGATGGGTTCAGCATGCTGGAAAAGAAGCTTACAGAGGGAGGGGATATCCACCAAATTTTACGATCACACCCGATTGCTGCTGACTTAAAACAAAGAACAGACCGATTTGTAAAGAGTCTTGGTGGTCGCGACTCACAGTTACAGAATTGCTGGCTGGAATTCAAGAGCAAAGCATTCTCAAGGCAAGACACAGGGACTGTACCAGAGCTCCTTCATGCTTGTAGGAACATGAACCGACAGCTGTGCTCTGTGTATCGGCAGCTATTTCTAGTGTCTCTGATGAGTGGAACACATTCCCTCTCCTTAAATATGCAGTCCAAGGTCCGGAAACTGGTCCAGGGGAAGCTGACTGACTGGCAGGAGTTTCTGCTGGTGAAGAGTAAAAGAAACACTACGATGGTTAATTACTTGGAAGATTTTCCAGGCTTGATACATTTTATCTACGTGGATCGGACTGTAGGCCAAATGGTGGCCCCCTCTATAAATACTGATAGCAAAACATCTTCCGAGCTGGGAACTGGATTGTTGGCCAGTTTTATTAAAAATAAGGTTTGGTCCTTCATTGGTTTGTCACGGAGATACCTTCAGAAAGGATACACAACGCTAACTCTGCGAGATGGGGACTATTATTGCTGCTACTTCCTCTGGTTTGAGAATGAAGCAGGTGATAAACTTGAAATCATTGAGGTTCCTGTTTTAGGAGATGATTCTGCTCCTATAGGAATGCTGGCAGGCGAATATTACAGGAAACTGCTTCGCTACTACAGCAAAAACCACCAGACAGAGCTGGTTAAATGCTATGAACTGCTCACCCTGCACTTGGGCATCATCCCTCCAGAGTTTGTGATCCAGCAGTGCCATGATCTAGCCCGCAAGCTATGGGAACCATCCCGGATCCCTCTTCTATAG
Full Trace Sequence: ctcgctggtcacatgccctgtgcaggaactgttccctgatagaagtagttgcgggactcagtccgagttgtgaggaggagcacctttgggcattcataaatgccaactggaaccttcctcatttctaagcagagatgaagatgagtgcatgaaaatgagctacaaatcaagggacctttcctactgattacctctagagggccacattattctgcaatatctgggacactaagaactgcataaaaatgaaatgtgtacttattgcctccgagggagctgaagtcctgttctactgggcagatgaagagtttgagaagaacctgcagagcaaatatgattatactgaggaacagcagccaccaaactatggagacagcattaatactcttttcgctcctttaatcatctcttgtgttacaataatggagaagattaatgatacctatacatgtttcaccactgaaaaaggtcacctctgcgtccttcacatgtttggagaatgcctctacattgcagtaaatggtgatgaaactgaaaacgaggacgacctgcgcaggaaattgtatgtccttaagagactctgtgaggtgcattttggtctggtcacgtttgacagccatttgattaagaaggaactgcgccctgcagattctgaacagcgcaatctagtatggaagacctttcagagcttgcttctgacatacagtcgactgcgaaatgaggaccagagctttgctgttgaggcagtggagcgcctgattcacccaaagctctgtgagcagtgcatcgagttcctggagaaacagattgtccatttcattaacagcagcagtgagcggggggcagaggaggtcctgcatgcttttgtactggtcaacacaaaacttctggctcttttctcaagtcgaaacgccagttctttgagacctgcagatctactctccttaattctcatagttcaggatttgtatcccaacttcagtactcaagagcgaaatgtggaggagaatgaagacaatgcgccttcagaggagtattacaccccagatccatcgcccaataacaggagtttaagtggtggcagctgggtggatgatgattcccctgcacttagttatgttgatcctgaaatccagattgctgaagacagtttgaaaacccttgtgggagacatccctgaatctactaacacaagaagagtttttttggatgcaaccctaaaagaaggctattgtcccatgatgccacattccatgtactgcttaccactttggccgggaatatccctggtcctgctgactaagttgtcaggcagccatattgccctctctctgtatcagctcctagatgggttcagcatgctggaaaagaagcttacagagggaggggatatccaccaaattttacgatcacacccgattgctgctgacttaaaacaaagaacagaccgatttgtaaagagtcttggtggtcgcgactcacagttacagaattgctggctggaattcaagagcaaagcattctcaaggcaagacacagggactgtaccagagctccttcatgcttgtaggaacatgaaccgacagctgtgctctgtgtatcggcagctatttctagtgtctctgatgagtggaacacattccctctccttaaatatgcagtccaaggtccggaaactggtccaggggaagctgactgactggcaggagtttctgctggtgaagagtaaaagaaacactacgatggttaattacttggaagattttccaggcttgatacattttatctacgtggatcggactgtaggccaaatggtggccccctctataaatactgatagcaaaacatcttccgagctgggaactggattgttggccagttttattaaaaataaggtttggtccttcattggtttgtcacggagataccttcagaaaggatacacaacgctaactctgcgagatggggactattattgctgctacttcctctggtttgagaatgaagcaggtgataaacttgaaatcattgaggttcctgttttaggagatgattctgctcctataggaatgctggcaggcgaatattacaggaaactgcttcgctactacagcaaaaaccaccagacagagctggttaaatgctatgaactgctcaccctgcacttgggcatcatccctccagagtttgtgatccagcagtgccatgatctagcccgcaagctatgggaaccatcccggatccctcttctatagaggaacaggaggagccaccagtattgtaaattcaccagatcattcccacctaactgtgcctatttacatgagcaatgctgctcctagagacattctgtagtattaaatataatcaggtgactgatgttattaatgttcggattgcactgaactgcactgaagccaaacattcccttagttgccttgtggcacagtacagatgcatgggagtgactgctgcaatctcctgcaatcttgctccataatagttatagtgtgtccatgcaccatctgaccctaggacatcaatggggtttaataatgtatatacaaagttggccaagtgtagttactactatgaacaaagctttagtcttagcctgcaataccttataaacaagcagtttgaaaaaagcatacttggggcagggcagagaggccttttgctccctttttatttacaataaaataatacatttgacagtcaccgctcacagagcattatttttttgttgctggtgtcagtgaccccaaaaaacagatgttattttggaaagtggcaaacaattcaacaattataaagcactaaagatcaatcagttgccaataggatattctggaagatactaaaagtttatttgatggtgacctacgcctttaatggacttggtagctgataccccaatcttgcaactgtgagattttgctttctccctccctttgccattatgtgtctggatccttcatggctgtaagtgaggaatcagtgcataactatcagactgccttcatatgccaagttgaaaacaaccacagaatatacctggcacagaccccaggctgtatttttgtaacctgcaacaaagtgtagatagaaagaaatctgtatagaaaatatccatttggtacgacaaattctgtaagttttaacaaatactttggaataaaataacatgattatacattaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MKCVLIASEGAEVLFYWADEEFEKNLQSKYDYTEEQQPPNYGDSINTLFAPLIISCVTIMEKINDTYTCFTTEKGHLCVLHMFGECLYIAVNGDETENEDDLRRKLYVLKRLCEVHFGLVTFDSHLIKKELRPADSEQRNLVWKTFQSLLLTYSRLRNEDQSFAVEAVERLIHPKLCEQCIEFLEKQIVHFINSSSERGAEEVLHAFVLVNTKLLALFSSRNASSLRPADLLSLILIVQDLYPNFSTQERNVEENEDNAPSEEYYTPDPSPNNRSLSGGSWVDDDSPALSYVDPEIQIAEDSLKTLVGDIPESTNTRRVFLDATLKEGYCPMMPHSMYCLPLWPGISLVLLTKLSGSHIALSLYQLLDGFSMLEKKLTEGGDIHQILRSHPIAADLKQRTDRFVKSLGGRDSQLQNCWLEFKSKAFSRQDTGTVPELLHACRNMNRQLCSVYRQLFLVSLMSGTHSLSLNMQSKVRKLVQGKLTDWQEFLLVKSKRNTTMVNYLEDFPGLIHFIYVDRTVGQMVAPSINTDSKTSSELGTGLLASFIKNKVWSFIGLSRRYLQKGYTTLTLRDGDYYCCYFLWFENEAGDKLEIIEVPVLGDDSAPIGMLAGEYYRKLLRYYSKNHQTELVKCYELLTLHLGIIPPEFVIQQCHDLARKLWEPSRIPLL
Donor tissue: tailbud