ORFeome > hspa9 – XORFeome 2.0

hspa9 – XORFeome 2.0

General Information

Species: Xenopus tropicalis heat shock 70kDa protein 9 (mortalin), mRNA (cDNA clone MGC:69535 IMAGE:5336625), complete cds
Gene Symbol: hspa9
Gene ID: 407910
ORF gb_acc: MG133385
ORF ID: 10892

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC067910

Library Location

Plate ID: GDExt11008
Well Location: H11

EST Sequences

Clone: MGC:69535 IMAGE:5336625
Trimmed Sequence: ATGCTGACTGCCAGCGGGTCCGTAGCCTCGTCCCTCTCACATGTGTCACGGATACTTCGCAAGGGCTGTTTTAATGGTCTCAGCCAAGATGTTCTGCAATCAGTGTTTAAACGGGACTATGCATCTGAATCAATTAAAGGTGCTGTCATTGGTATTGATCTAGGAACAACAAATTCTTGTGTTGCCATAATGGAGGGAAAGCAAGCAAAGGTCCTTGAAAATTCTGAAGGGGCTAGAACCACACCTTCAGTAGTAGCGTTTTCATCAGATGCTGAACGTTTAGTGGGAATGCCAGCTAAACGACAGGCAGTCACTAACCCCAACAACACATTCTACGCAACAAAGCGCCTCATTGGCCGACGTTTTGATGACCCTGAAGTTCAAAAAGACATTAAAAATGTACCTTTCAAAATTGTGAAAGCCTCAAATGGCGATGCCTGGTTGGAATCCCATGGAAAACTGTATTCCCCAAGTCAGATTGGCGCATTTGTTTTAATGAAAATGAAAGAGACTGCTGAAAACTATTTGGGTCACGCTGCCAAAAATGCTGTTATCACTGTGCCTGCATACTTCAATGACTCTCAGCGACAGGCGACAAAGGATGCTGGGCAAATTTCTGGGCTGAATGTCTTGAGAGTTATTAATGAACCTACTGCCGCTGCCCTTGCCTATGGACTAGATAAATCTGATGACAAAATTATTGCGGTCTATGATCTTGGGGGAGGAACATTTGATATTTCGATTCTAGAAATTCAGAAGGGGGTTTTTGAAGTAAAATCCACAAATGGAGACACATTCCTTGGAGGTGAAGATTTTGATCAAGCTTTGCTGCAGCATATTGTAAAGCAGTTCAAAAGAGAGTCTGGTGTGGACCTTACCAAAGACAATATGGCACTTCAGAGAGTCCGAGAAGCTGCTGAAAAAGCAAAATGTGAGCTGTCTTCCGCTTTGCAGACTGACATCAATCTGCCATACCTCACCATGGATGCTTCTGGACCAAAACACTTAAATATGAAATTGACACGTGCTCAGTTTGAGGGAATTGTTGCTGATTTAATAAAGAGGACAGTTGCACCTAGCCAAAAAGCTATGCAAGACGCAGAAGTTGGCAAAAGTGACATTGGTGAAGTTTTGTTGGTCGGTGGAATGACAAGAATGCCAAAGGTTCAGCAAACCGTGCAAGATTTGTTTGGACGAGCACCAAGCAAAGCCGTAAATCCGGATGAAGCAGTTGCCATTGGAGCTGCCATTCAAGGTGGCGTGTTAGCAGGAGATGTTACAGATGTCTTGTTGTTGGATGTCACACCATTATCTCTTGGCATTGAAACACTTGGAGGAGTCTTTACCAAGCTGATTGGAAGAAACACTACTATACCAACCAAAAAAAGCCAGGTCTTCTCTACTGCTGCGGATGGCCAAACACAGGTAGAAATTAAAGTTCATCAAGGAGAGAGAGAAATGGCCAGTGACAATAAACTTCTTGGTCAGTTTACATTGGTTGGAATCCCCCCTGCGCCTCGTGGAGTGCCTCAGATTGAAGTCACTTTTGACATTGATGCAAATGGAATTGTTCATGTATCTGCAAAAGACAAAGGGACAGGCCGTGAACAACAAATTGTTATTCAGTCTTCTGGTGGACTTAGCAAAGATGACATTGAGAATATGGTAAAGAATGCAGAAAAGTATGCAGAGGAGGATAGAAGGAGAAAGGAACGTGTGGAGGCGGTTAACAATGCTGAAGGTATTATTCATGACACAGAGTCAAAAATGGAGGAATTTAAGGATCAGCTGCCAGCTGATGAGTGCAACAAACTTAAAGAAGAGATAAGCAAGGTAAAAGAACTCCTGACACGAAAAGACGAAGAAACTGGGGAGACCATCAGAAATGCTTCATCAACTCTCCAACAGGCTTCACTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATCTGAAAGAAGCAGCACTGAAAGTGGACAACAAAAAGAGGACCAGAAGGAAGAAAAACAATAA
Full Trace Sequence: tggttaagaggcttctagaagtgctgaagggtttctttcctgctggtactgacctagtgaaggttccccaagtctccctgtgtgactgtatctatcggtctcatcatgctgactgccagcgggtccgtagcctcgtccctctcacatgtgtcacggatacttcgcaagggctgttttaatggtctcagccaagatgttctgcaatcagtgtttaaacgggactatgcatctgaatcaattaaaggtgctgtcattggtattgatctaggaacaacaaattcttgtgttgccataatggagggaaagcaagcaaaggtccttgaaaattctgaaggggctagaaccacaccttcagtagtagcgttttcatcagatgctgaacgtttagtgggaatgccagctaaacgacaggcagtcactaaccccaacaacacattctacgcaacaaagcgcctcattggccgacgttttgatgaccctgaagttcaaaaagacattaaaaatgtacctttcaaaattgtgaaagcctcaaatggcgatgcctggttggaatcccatggaaaactgtattccccaagtcagattggcgcatttgttttaatgaaaatgaaagagactgctgaaaactatttgggtcacgctgccaaaaatgctgttatcactgtgcctgcatacttcaatgactctcagcgacaggcgacaaaggatgctgggcaaatttctgggctgaatgtcttgagagttattaatgaacctactgccgctgcccttgcctatggactagataaatctgatgacaaaattattgcggtctatgatcttgggggaggaacatttgatatttcgattctagaaattcagaagggggtttttgaagtaaaatccacaaatggagacacattccttggaggtgaagattttgatcaagctttgctgcagcatattgtaaagcagttcaaaagagagtctggtgtggaccttaccaaagacaatatggcacttcagagagtccgagaagctgctgaaaaagcaaaatgtgagctgtcttccgctttgcagactgacatcaatctgccatacctcaccatggatgcttctggaccaaaacacttaaatatgaaattgacacgtgctcagtttgagggaattgttgctgatttaataaagaggacagttgcacctagccaaaaagctatgcaagacgcagaagttggcaaaagtgacattggtgaagttttgttggtcggtggaatgacaagaatgccaaaggttcagcaaaccgtgcaagatttgtttggacgagcaccaagcaaagccgtaaatccggatgaagcagttgccattggagctgccattcaaggtggcgtgttagcaggagatgttacagatgtcttgttgttggatgtcacaccattatctcttggcattgaaacacttggaggagtctttaccaagctgattggaagaaacactactataccaaccaaaaaaagccaggtcttctctactgctgcggatggccaaacacaggtagaaattaaagttcatcaaggagagagagaaatggccagtgacaataaacttcttggtcagtttacattggttggaatcccccctgcgcctcgtggagtgcctcagattgaagtcacttttgacattgatgcaaatggaattgttcatgtatctgcaaaagacaaagggacaggccgtgaacaacaaattgttattcagtcttctggtggacttagcaaagatgacattgagaatatggtaaagaatgcagaaaagtatgcagaggaggatagaaggagaaaggaacgtgtggaggcggttaacaatgctgaaggtattattcatgacacagagtcaaaaatggaggaatttaaggatcagctgccagctgatgagtgcaacaaacttaaagaagagataagcaaggtaaaagaactcctgacacgaaaagacgaagaaactggggagaccatcagaaatgcttcatcaactctccaacaggcttcacttaaattatttgaaatggcttacaaaaagatggcatctgaaagaagcagcactgaaagtggacaacaaaaagaggaccagaaggaagaaaaacaataaagtgcgttggtgcaaaaggcgcttgggagttaactattcagaactgagaattcaccatagtcctgagcaaaaattaccataaatcttttactgtatttttgcagtactctttatcgtttgttgctgttgttttagttggatattcgttttttctttttttctacaaataataattaaaaaaaatccactgtccattcctgtgaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MLTASGSVASSLSHVSRILRKGCFNGLSQDVLQSVFKRDYASESIKGAVIGIDLGTTNSCVAIMEGKQAKVLENSEGARTTPSVVAFSSDAERLVGMPAKRQAVTNPNNTFYATKRLIGRRFDDPEVQKDIKNVPFKIVKASNGDAWLESHGKLYSPSQIGAFVLMKMKETAENYLGHAAKNAVITVPAYFNDSQRQATKDAGQISGLNVLRVINEPTAAALAYGLDKSDDKIIAVYDLGGGTFDISILEIQKGVFEVKSTNGDTFLGGEDFDQALLQHIVKQFKRESGVDLTKDNMALQRVREAAEKAKCELSSALQTDINLPYLTMDASGPKHLNMKLTRAQFEGIVADLIKRTVAPSQKAMQDAEVGKSDIGEVLLVGGMTRMPKVQQTVQDLFGRAPSKAVNPDEAVAIGAAIQGGVLAGDVTDVLLLDVTPLSLGIETLGGVFTKLIGRNTTIPTKKSQVFSTAADGQTQVEIKVHQGEREMASDNKLLGQFTLVGIPPAPRGVPQIEVTFDIDANGIVHVSAKDKGTGREQQIVIQSSGGLSKDDIENMVKNAEKYAEEDRRRKERVEAVNNAEGIIHDTESKMEEFKDQLPADECNKLKEEISKVKELLTRKDEETGETIRNASSTLQQASLKLFEMAYKKMASERSSTESGQQKEDQKEEKQ
Donor tissue: tailbud