ORFeome > ikbkb – XORFeome 2.0

ikbkb – XORFeome 2.0

General Information

Species: Xenopus tropicalis inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase beta, mRNA (cDNA clone MGC:69241 IMAGE:5307924), complete cds
Gene Symbol: ikbkb
Gene ID: 448125
ORF gb_acc: MG133204
ORF ID: 10669

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC074657

Library Location

Plate ID: GDExt11006
Well Location: G07

EST Sequences

Clone: MGC:69241 IMAGE:5307924
Trimmed Sequence: ATGAAGGAACGCTTGGGAACTGGGGGATTTGGTTATGTCTTGCGCTGGATTCACCAGGATACTGGTGAGCAAGTGGCAATAAAGCAGTGCCGGCAGGAGCTGAGCCCTAAGAACCGAGAGAGATGGTGCCTGGAAATCCAGATCATGAAAAAGTTGAATCACCCTAATGTGGTCTCTGCCCGTGAAGTTCCTGATGGGCTACAGAAACTGGCCCCCAATGACCTCCCCCTTCTGGCCATGGAATACTGTGAGGGGGGTGACCTGCGCAAGTATCTGAATCAGTTCGAGAATTGCTGTGGCCTTAAGGAGGGACCCATACTGACTCTGCTCAGTGATATTTCCTCTGCCCTTCGATACCTCCATGAGAACAGGATAATCCACAGAGATCTGAAGCCAGAGAACATTGTTCTGCAGCCAGGACCCCAGAGACTGATCCATAAAATTATTGATTTGGGATATGCCAAGGAGCTTGATCAGGGGAGTCTATGCACATCATTTGTGGGTACCCTGCAGTATTTGGCCCCAGAATTACTAGAGCAGAAGAAGTACACAGTGACTGTTGATTACTGGAGTTTCGGGACACTAGCCTTTGAATGTATAACAGGATTCCGACCTTTCCTTCCCAACTGGCAACCTGTTCAGTGGCATGGAAAAGTGCGAGAGAAAAGCAATGAGCACATTGTGGTATACGAGGACCTGATGGGAGCTGTAAAGTTCTCCAGTGTCTTACCAACACCCAATCATCTGAACAGCAAGCTGGCTGGCAAGTTGGAACACTGGCTACAATGCATGCTAATGTGGCACCAGAGACAGAGAGGCACAGATCCACAGAACCCTAATGTTGGTTGTTTCCAGGCCTTGGATTCCATCCTAAGCCTTAAGCTGCTGTCTGTACTGAACATGGTGTCTGGCAAGGTGCACACTTACCCGGTGTCAGAGAATGAAAACCTGCAGAATCTGAAGAGTCGCCTGGAGCAAGACACAGGGATTCCTGAGGAAGAGCAGGAACTATTGCAGGCATCAGGATTGGCCCTTAATCCTGCCCAGCCTCTAACCCAGTTTGTGGTAGACTGCACGGTCAATGATGGGCGTCAGGGCGAGGGTGATCTGATATTTCTATTTGATAACCGGAAGACTGTATATGAGCCCCAGATATCACTGCCGGCACATCCCGAGAGTGTCACCGTTATATTGCAGGATCCCAAACGGCCCCTCACTTACACCCACCTTCGCCGCGTGTGGGGGCAGACCTGGCAGACAATACGAGCGATGAAAGAGGATTGTGCCCGTCTGCTTCATGGGCAGCGTACCTTTATGGTAAACCTGCTGCGATACAATACTGAACTTTCCAAAAAGAAGAACCTCATGACTTCTGAGTTTGAGCAGCTAAAGGCCAAACTGGATTTCTTCCGGAACAGTATCCAGATTGATCTAGAAAAATACAGTGAACAGATGGAGTTTGGAATCACTTCTGAAAAGCTCCTGTCAGCCTGGAGAGAGACGGAGCAAACAGTGGAACTGTGCGGCAGGGAGAGGGAAGTGCAGGCTCTTGTGGATAAAATGATGGCTTTACAAACAGACAGTGTAGATCTGCAGAGAAATCCATTAGGCAGGAAACACCGAGGGACACTGGATGACCTAGAAGAACAGGCTAAAGATTTATATCGGCGGTTACGGGAGAGACCTAGAGATCAAAGGACAGCAGGAGACAGCAATGAAATGGTGCGCCTCCTAATTCAAGCCATCCAGAGCTTCGAGAAGAGAGTCATCCTTATATATGACCAACTCAGTAAGACTGTGGCGTGCAAGCACAAAGCCCTAGAACTATCCCCAAAGGTGAAAGAGGTGATGAACCTAATGAGAGAAGATGAAAAAATGGTGGTAAAGAGGCAAGAGAAGAGACAGCAGGAGCTGTGGAACCTGCTAAAGATTGCTTGTAGCAAAGTCCGTGGCCCTGTGAGTGGTAGCCCAGATAGCTTGGGCACATCTCGAATGCCTGGCCCAAGCCAACTGCTTTCCCAGCCTCCTGCCCTCTCTGCCAGTCTAGCCCAAGAGTATGTGAAGAAAAGTGAAGATCTTCTCTCTGAGTCTTTGAAACTGTGCAGGCAAATGGAAACTTCAATGATGGGCTTTATGAAGGAACAAGACAGTAGTCTCATGTCCTTAGATTGGTCGTGGCTATCGCAGCAAGAGGAGGCATCTGGCACATCACCCATTACAACCACGTGA
Full Trace Sequence: ggatgttgagagctgagaagcaacacaggggcactgaggctagcaagtagggggtttgctctagtagtcacacactcagctgtgcccaggggcactagtcatgctgcgggactgcctctcattgtagccccaagctgcccccaggctctgtacctcataccccagtactgggaagcaccaagcagccggccaggcagggcgcccagctcttcctctcactcacacactcacacactgacagacagacagacacgcccccggctctgcatatgacacaccaggatgcctcccctggcagggccggctgggcaccgccaccctcacacacgcagatatgtggcccctgggagatgaaggaacgcttgggaactgggggatttggttatgtcttgcgctggattcaccaggatactggtgagcaagtggcaataaagcagtgccggcaggagctgagccctaagaaccgagagagatggtgcctggaaatccagatcatgaaaaagttgaatcaccctaatgtggtctctgcccgtgaagttcctgatgggctacagaaactggcccccaatgacctcccccttctggccatggaatactgtgaggggggtgacctgcgcaagtatctgaatcagttcgagaattgctgtggccttaaggagggacccatactgactctgctcagtgatatttcctctgcccttcgatacctccatgagaacaggataatccacagagatctgaagccagagaacattgttctgcagccaggaccccagagactgatccataaaattattgatttgggatatgccaaggagcttgatcaggggagtctatgcacatcatttgtgggtaccctgcagtatttggccccagaattactagagcagaagaagtacacagtgactgttgattactggagtttcgggacactagcctttgaatgtataacaggattccgacctttccttcccaactggcaacctgttcagtggcatggaaaagtgcgagagaaaagcaatgagcacattgtggtatacgaggacctgatgggagctgtaaagttctccagtgtcttaccaacacccaatcatctgaacagcaagctggctggcaagttggaacactggctacaatgcatgctaatgtggcaccagagacagagaggcacagatccacagaaccctaatgttggttgtttccaggccttggattccatcctaagccttaagctgctgtctgtactgaacatggtgtctggcaaggtgcacacttacccggtgtcagagaatgaaaacctgcagaatctgaagagtcgcctggagcaagacacagggattcctgaggaagagcaggaactattgcaggcatcaggattggcccttaatcctgcccagcctctaacccagtttgtggtagactgcacggtcaatgatgggcgtcagggcgagggtgatctgatatttctatttgataaccggaagactgtatatgagccccagatatcactgccggcacatcccgagagtgtcaccgttatattgcaggatcccaaacggcccctcacttacacccaccttcgccgcgtgtgggggcagacctggcagacaatacgagcgatgaaagaggattgtgcccgtctgcttcatgggcagcgtacctttatggtaaacctgctgcgatacaatactgaactttccaaaaagaagaacctcatgacttctgagtttgagcagctaaaggccaaactggatttcttccggaacagtatccagattgatctagaaaaatacagtgaacagatggagtttggaatcacttctgaaaagctcctgtcagcctggagagagacggagcaaacagtggaactgtgcggcagggagagggaagtgcaggctcttgtggataaaatgatggctttacaaacagacagtgtagatctgcagagaaatccattaggcaggaaacaccgagggacactggatgacctagaagaacaggctaaagatttatatcggcggttacgggagagacctagagatcaaaggacagcaggagacagcaatgaaatggtgcgcctcctaattcaagccatccagagcttcgagaagagagtcatccttatatatgaccaactcagtaagactgtggcgtgcaagcacaaagccctagaactatccccaaaggtgaaagaggtgatgaacctaatgagagaagatgaaaaaatggtggtaaagaggcaagagaagagacagcaggagctgtggaacctgctaaagattgcttgtagcaaagtccgtggccctgtgagtggtagcccagatagcttgggcacatctcgaatgcctggcccaagccaactgctttcccagcctcctgccctctctgccagtctagcccaagagtatgtgaagaaaagtgaagatcttctctctgagtctttgaaactgtgcaggcaaatggaaacttcaatgatgggctttatgaaggaacaagacagtagtctcatgtccttagattggtcgtggctatcgcagcaagaggaggcatctggcacatcacccattacaaccacgtgagacgcggaaacagcagatgtatcggacgcaatggaactgtgcctttaaatcatatatctctaggatttatgcagaaaaagcacttaaccatgccaacacatactttgccttttgtcaaggactgttatattaaacattcagaagccatgactggctgatcaaactctagccattttgtgagggtctcatacagataaccttgtgtgcttacagctgctcagtgcagaaccactggagaatattacagacaaggctgttatcagggaaaaattgcagtgtaggattgtaaaataatatttttatatatccacttatcagagtgtattcatatgtttaatttttacatgttaaacttcaaagaaatgcctgtgaataaataagcttttaccaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MKERLGTGGFGYVLRWIHQDTGEQVAIKQCRQELSPKNRERWCLEIQIMKKLNHPNVVSAREVPDGLQKLAPNDLPLLAMEYCEGGDLRKYLNQFENCCGLKEGPILTLLSDISSALRYLHENRIIHRDLKPENIVLQPGPQRLIHKIIDLGYAKELDQGSLCTSFVGTLQYLAPELLEQKKYTVTVDYWSFGTLAFECITGFRPFLPNWQPVQWHGKVREKSNEHIVVYEDLMGAVKFSSVLPTPNHLNSKLAGKLEHWLQCMLMWHQRQRGTDPQNPNVGCFQALDSILSLKLLSVLNMVSGKVHTYPVSENENLQNLKSRLEQDTGIPEEEQELLQASGLALNPAQPLTQFVVDCTVNDGRQGEGDLIFLFDNRKTVYEPQISLPAHPESVTVILQDPKRPLTYTHLRRVWGQTWQTIRAMKEDCARLLHGQRTFMVNLLRYNTELSKKKNLMTSEFEQLKAKLDFFRNSIQIDLEKYSEQMEFGITSEKLLSAWRETEQTVELCGREREVQALVDKMMALQTDSVDLQRNPLGRKHRGTLDDLEEQAKDLYRRLRERPRDQRTAGDSNEMVRLLIQAIQSFEKRVILIYDQLSKTVACKHKALELSPKVKEVMNLMREDEKMVVKRQEKRQQELWNLLKIACSKVRGPVSGSPDSLGTSRMPGPSQLLSQPPALSASLAQEYVKKSEDLLSESLKLCRQMETSMMGFMKEQDSSLMSLDWSWLSQQEEASGTSPITTT
Donor tissue: gastrula