ORFeome > impdh2 – XORFeome 2.0

impdh2 – XORFeome 2.0

General Information

Species: Xenopus tropicalis IMP (inosine monophosphate) dehydrogenase 2, mRNA (cDNA clone MGC:79663 IMAGE:6980381), complete cds
Gene Symbol: impdh2
Gene ID: 493428
ORF gb_acc: MG133737
ORF ID: 11305

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC080955

Library Location

Plate ID: GDExt11012
Well Location: C04

EST Sequences

Clone: MGC:79663 IMAGE:6980381
Trimmed Sequence: ATGGCGGACTATCTGATCAGCGGAGGGACCAGCTATGTCCCGGATGATGGGCTGACTGCGCAGCAGCTCTTCGGGGCCGGAGACGGGCTCACCTACAATGACTTCCTCATCCTCCCGGGGTACATCGACTTCACAGCTGACCAAGTGGATCTCACCTCAGCCCTCACAAAGAAAATCACCTTAAAGACCCCGATGGTTTCCTCCCCCATGGATACGGTTACAGAAGCCAGTATGGCTATCGCAATGGCGTTAACAGGTGGAATTGGCATCATGCATCACAACTGCACCCCTGAATTCCAGGCCAACGAAGTACGGAAAGTAAAGAAATACGAACAAGGGTTCATCACAGATCCAGTGGTGCTAAGTCCCAAACACAGAGTCCGAGATGTATTTGAGGCCAAGGCCCGGCATGGATTCTGTGGGATTCCCATCACTGAGAATGGCAAGATGGGCAGCAAGCTGGCGGGAATCATTTCATCCAGGGACATCGACTTCCTGAAATCCGAAGAGCACGACCTTGCACTCAGTGAGATAATGACCCGGAGAGAAGACCTTGTTGTAGCACCTGCTGGAGTGACGTTAAAGGAGGCCAATGAAATTTTACAGAGGAGTAAAAAAGGCAAGTTGCCCATTGTTAATGGCAATGACGAGCTGGTGGCCATAATTGCTCGCACTGACCTGAAGAAGAACCGCGATTATCCACTGGCTTCCAAAGATGCAAAGAAACAGTTGCTATGCGGGGCGGCCATTGGTACCCACGAGGATGATAAATATCGGCTGGATCTGCTGGTGCAAGCCGGTGTGGATGCCGTGGTCCTTGATTCATCACAAGGAAATTCCATTTTCCAAATCAATATGATCAAGTTCATCAAGGAGAAGTACCAAGATCTTCAGGTGATCGCTGGCAACGTCGTGACTGCTGCTCAAGCGAAGAATCTGATTGACGCAGGGGCTGATGCGCTGAGAGTGGGAATGGGGAGCGGCTCAATTTGTATCACGCAGGAAGTGCTGGCGTGTGGGAGGCCTCAGGCCACAGCGGTGTACAAAGTGTCTGAGTATGCGAGGAGGTTTGGCGTTCCCGTAATTGCCGATGGCGGCATACAGACTGTCGGACACATTGCAAAGGCCTTGGCACTGGGCGCTTCCACAGTCATGATGGGCTCCCTACTGGCAGCCACCACAGAGGCCCCGGGGGAGTACTTCTTCTCAGATGGCATAAGGTTAAAGAAGTACCGAGGCATGGGCTCTCTGGATGCCATGGACAAGAACGTCAGCAGCCAGAAGAGATACTTCAGCGAGGCGGATAAGATTAAGGTTGCGCAGGGCGTGTCTGGGGCTGTCCAGGACAAGGGATCCATTCACAAGTTTATTCCATATTTAATTGCTGGAATCCAGCATTCGTGCCAGGACATTGGTGCCAAGAGCCTAACGCAAGTCAGGGCCATGATGTATTCAGGAGAACTCAAGTTTGAGAAGAGGACCATGTCTGCCCAGGTGGAAGGAGGAGTGCATGGACTACACTCGTACGAGAAGCGACTATTCTAA
Full Trace Sequence: gaaggcacagaggtggcggcagggcagccggggtgtgttggcggcactttaggttcacacatggcggactatctgatcagcggagggaccagctatgtcccggatgatgggctgactgcgcagcagctcttcggggccggagacgggctcacctacaatgacttcctcatcctcccggggtacatcgacttcacagctgaccaagtggatctcacctcagccctcacaaagaaaatcaccttaaagaccccgatggtttcctcccccatggatacggttacagaagccagtatggctatcgcaatggcgttaacaggtggaattggcatcatgcatcacaactgcacccctgaattccaggccaacgaagtacggaaagtaaagaaatacgaacaagggttcatcacagatccagtggtgctaagtcccaaacacagagtccgagatgtatttgaggccaaggcccggcatggattctgtgggattcccatcactgagaatggcaagatgggcagcaagctggcgggaatcatttcatccagggacatcgacttcctgaaatccgaagagcacgaccttgcactcagtgagataatgacccggagagaagaccttgttgtagcacctgctggagtgacgttaaaggaggccaatgaaattttacagaggagtaaaaaaggcaagttgcccattgttaatggcaatgacgagctggtggccataattgctcgcactgacctgaagaagaaccgcgattatccactggcttccaaagatgcaaagaaacagttgctatgcggggcggccattggtacccacgaggatgataaatatcggctggatctgctggtgcaagccggtgtggatgccgtggtccttgattcatcacaaggaaattccattttccaaatcaatatgatcaagttcatcaaggagaagtaccaagatcttcaggtgatcgctggcaacgtcgtgactgctgctcaagcgaagaatctgattgacgcaggggctgatgcgctgagagtgggaatggggagcggctcaatttgtatcacgcaggaagtgctggcgtgtgggaggcctcaggccacagcggtgtacaaagtgtctgagtatgcgaggaggtttggcgttcccgtaattgccgatggcggcatacagactgtcggacacattgcaaaggccttggcactgggcgcttccacagtcatgatgggctccctactggcagccaccacagaggccccgggggagtacttcttctcagatggcataaggttaaagaagtaccgaggcatgggctctctggatgccatggacaagaacgtcagcagccagaagagatacttcagcgaggcggataagattaaggttgcgcagggcgtgtctggggctgtccaggacaagggatccattcacaagtttattccatatttaattgctggaatccagcattcgtgccaggacattggtgccaagagcctaacgcaagtcagggccatgatgtattcaggagaactcaagtttgagaagaggaccatgtctgcccaggtggaaggaggagtgcatggactacactcgtacgagaagcgactattctaaagccaccggtgccgccatccatttgcctgatgccgccatgcccctacagcagaaactgtgcctgccgacatactgcatgtgcttgccgtatggatcaccacgggctgccttagccacatctgcctgacttcatgccaaggactgttagacgcacaggggcatgggcatcccaccctttgctttacagagggcttccaataaagaaggtgcctgccgctgcccgagcatgcctcacacccaagcccttatcctgtgtaaccgccacatgagtttcatctcacagaatggaaaagctgaatgattaccattttttatgtcccatttgactgcaaataaacactgaaacatgtataaattaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MADYLISGGTSYVPDDGLTAQQLFGAGDGLTYNDFLILPGYIDFTADQVDLTSALTKKITLKTPMVSSPMDTVTEASMAIAMALTGGIGIMHHNCTPEFQANEVRKVKKYEQGFITDPVVLSPKHRVRDVFEAKARHGFCGIPITENGKMGSKLAGIISSRDIDFLKSEEHDLALSEIMTRREDLVVAPAGVTLKEANEILQRSKKGKLPIVNGNDELVAIIARTDLKKNRDYPLASKDAKKQLLCGAAIGTHEDDKYRLDLLVQAGVDAVVLDSSQGNSIFQINMIKFIKEKYQDLQVIAGNVVTAAQAKNLIDAGADALRVGMGSGSICITQEVLACGRPQATAVYKVSEYARRFGVPVIADGGIQTVGHIAKALALGASTVMMGSLLAATTEAPGEYFFSDGIRLKKYRGMGSLDAMDKNVSSQKRYFSEADKIKVAQGVSGAVQDKGSIHKFIPYLIAGIQHSCQDIGAKSLTQVRAMMYSGELKFEKRTMSAQVEGGVHGLHSYEKRLF
Donor tissue: tailbud