ORFeome > irf2bp2 – XORFeome 2.0

irf2bp2 – XORFeome 2.0

General Information

Species: Xenopus tropicalis interferon regulatory factor 2 binding protein 2, mRNA (cDNA clone MGC:89525 IMAGE:6993033), complete cds
Gene Symbol: irf2bp2
Gene ID: 394851
ORF gb_acc: MG133964
ORF ID: 11562

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC075565

Library Location

Plate ID: GDExt11015
Well Location: H07

EST Sequences

Clone: MGC:89525 IMAGE:6993033
Trimmed Sequence: ATGTCGTCGGCGACGGTGGCCGCCTCCCGGCGGCAGTCGTGTTACCTTTGCGACCTGCCACGCATGCCATGGGCCATGATTTGGGACTTCACGGAGCCCGTGTGCCGGGGCTGCGTCAACTACGAAGGGGCCGATCGCATTGAGTTTGTCATCGAGACGGCCCGGCACTTGAAGCGGGCGCACGGGTTCCAGGAGGGCAGGTCCCCCGGGCCTTCGCCTTCATCCTCCTCGTCATCTTCCTCCTCCTCTTCAGTCAAGCCGCAGCTCAGCGCAAAGGAGATGGCGCAGATCGGGCACACGATGGGGGGCCCCGAGGGGGTAACACGGACCTCGCAGCAGCCCCCTCCTCCGCAGTGCCTGGACCGCTACTCGCTGGAGAGACCGCCGCCCCCTCGTCTGGGATCGGAATATGGCGTTGGCAGGCAAGTGAATGGGATTCTCTTACCCAACGGCTTCCCGAAGCCAGAGGAGCCGCCGGAACTAAACCGGCAGAGCCCCAACCCGCGCAGGACTAGCTCGGTGCCTCAGTCCCTCGGCGCACTTATGAACGGCGCCCCCATTGGCAGCGGCCGGACACCAGTCGGACTCTCTGCGGCCTCTTTGGTGGCAGCCGCCGCCGCCACCACCTCTGCGGACCTGTCTGGCAAGCGGCCGGGCTCTGTCTCCAGCAGTGAGCACGATGGCAAGGAGAAGCACAGGGCCGACAGCTACTCAGAGCTGGGCGAGAACCACAAGAGCAGGGCCGAGGAGTGGATCAGCAAGCCCAAGACGGTCAGGGACACTCTGATGGCCATGCAGCACAGCCACTCGCCCTTTGACTCCAAATTCAAGAAGGACCCCGGGCCCGGAAGGGTGCTGAGCTTTGAAGCCAACAACCCCGCTTCCAAATCTGGTGCCCGTGGTGGTAGAAAAAGGAAACCATCGCCAGAACCAGAAGGGGAAGGTGGCTCTGTCAAAATGAATGGAGAAGGACAACCGTGGCTGCCAGCGGCAGAGAGCCTTAAAATTTCTACAATGGCTAGCCCATCTTTTATATCTCCACCTTCTACTGTTTCTCCTCATTCCAACCGTACAACACCACCAGAAGCTGCACAAAATGGCCAGTCACCCATGGCTGCTCTGATATTAGTCGCTGATAACGCTGGTGGCAATCATGCATCAAAAGATGCTAACCAGGTGCATTCTACAACAAGAAGAAACAGTAGCAGTCCACCATCACCATCTTCTATGAACCAAAGAAGAATGGCTCCCAGGGATGTGCCAAGCCAAATTCCCAGTGGAGGAACATCATCCCATGCAGGAATGGAACAAGGGCATCCTCAAAGCATTCCCGACTCTTCTATACCAAACAGTATACCATTATGCTGCACTCTTTGCCATGAGCGTCTTGAAGACACACATTTTGTACAGTGCCCTTCCGTACCTTCTCATAAGTTTTGTTTCCCATGTTCAAGGCAAAGTATTAAACAACAAGGATCATCCGGAGAAGTATATTGTCCAAGTGGGGAGAAATGCCCCTTGGTGGGATCAAATGTACCATGGGCCTTCATGCAGGGAGAAATTGCCACCATTCTTGCCGGGGATGTAAAAGTGAAAAAAGAAAGGGACTCTTGA
Full Trace Sequence: ctagctgcggcggcggccagagagggaggcgggaaactacagcagtggcttcggcggctgtagaattactgtcccatacgtgaggacattttcctgtttcgctccggcaacacattatatttgttcggcgctcaccaagtgcacgaaagggttagccccgagttgttgtgagctcctggcagttcagggaagggggggccgctctggtgactgaagcagcagcctatcaccgggccggctcccctcccccctcctctccctccctccctggagctgtgcagctgaggaaagcgagagaagggagaagcacttcagaaaaaaaatatataataattcctcctcctcccgtggatccagagctgggcgtagtgtgtatgcttcaagccggaatcgccagcagcagccgaggcggagggcgccgccgccccgctcctcgaggctgagcccgaccattttcttttcagtgcaaggatcatccatcatacgggttgcaggggaggaaaattgcgccgatttccaaatttggaatatacctatttactggacagaacacacacaaataataaacggtggattataattttattgttatgtcgtcggcgacggtggccgcctcccggcggcagtcgtgttacctttgcgacctgccacgcatgccatgggccatgatttgggacttcacggagcccgtgtgccggggctgcgtcaactacgaaggggccgatcgcattgagtttgtcatcgagacggcccggcacttgaagcgggcgcacgggttccaggagggcaggtcccccgggccttcgccttcatcctcctcgtcatcttcctcctcctcttcagtcaagccgcagctcagcgcaaaggagatggcgcagatcgggcacacgatggggggccccgagggggtaacacggacctcgcagcagccccctcctccgcagtgcctggaccgctactcgctggagagaccgccgccccctcgtctgggatcggaatatggcgttggcaggcaagtgaatgggattctcttacccaacggcttcccgaagccagaggagccgccggaactaaaccggcagagccccaacccgcgcaggactagctcggtgcctcagtccctcggcgcacttatgaacggcgcccccattggcagcggccggacaccagtcggactctctgcggcctctttggtggcagccgccgccgccaccacctctgcggacctgtctggcaagcggccgggctctgtctccagcagtgagcacgatggcaaggagaagcacagggccgacagctactcagagctgggcgagaaccacaagagcagggccgaggagtggatcagcaagcccaagacggtcagggacactctgatggccatgcagcacagccactcgccctttgactccaaattcaagaaggaccccgggcccggaagggtgctgagctttgaagccaacaaccccgcttccaaatctggtgcccgtggtggtagaaaaaggaaaccatcgccagaaccagaaggggaaggtggctctgtcaaaatgaatggagaaggacaaccgtggctgccagcggcagagagccttaaaatttctacaatggctagcccatcttttatatctccaccttctactgtttctcctcattccaaccgtacaacaccaccagaagctgcacaaaatggccagtcacccatggctgctctgatattagtcgctgataacgctggtggcaatcatgcatcaaaagatgctaaccaggtgcattctacaacaagaagaaacagtagcagtccaccatcaccatcttctatgaaccaaagaagaatggctcccagggatgtgccaagccaaattcccagtggaggaacatcatcccatgcaggaatggaacaagggcatcctcaaagcattcccgactcttctataccaaacagtataccattatgctgcactctttgccatgagcgtcttgaagacacacattttgtacagtgcccttccgtaccttctcataagttttgtttcccatgttcaaggcaaagtattaaacaacaaggatcatccggagaagtatattgtccaagtggggagaaatgccccttggtgggatcaaatgtaccatgggccttcatgcagggagaaattgccaccattcttgccggggatgtaaaagtgaaaaaagaaagggactcttgactttttttagcttggtagcaaccattatctctaactaaaacttcttgagttgtgtgtatatatatatctatatatacccaagacaagggaaatgtagactgcataaacatggctgtataatttttaatttttgaatacattgtgtttctatttttgaagacaaaggtatgtactgattcaaaaggtatttcctctttgttaatgttatttgcaagtatttgttcttatccagtgacagttactgttcagtgtaggctgtgacttgagatgctttttagagcacttggaaaaacagaaatgcttttagctgtatttgtatgcacttgttaaaaatgccaaatacattttatgacattgtaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MSSATVAASRRQSCYLCDLPRMPWAMIWDFTEPVCRGCVNYEGADRIEFVIETARHLKRAHGFQEGRSPGPSPSSSSSSSSSSSVKPQLSAKEMAQIGHTMGGPEGVTRTSQQPPPPQCLDRYSLERPPPPRLGSEYGVGRQVNGILLPNGFPKPEEPPELNRQSPNPRRTSSVPQSLGALMNGAPIGSGRTPVGLSAASLVAAAAATTSADLSGKRPGSVSSSEHDGKEKHRADSYSELGENHKSRAEEWISKPKTVRDTLMAMQHSHSPFDSKFKKDPGPGRVLSFEANNPASKSGARGGRKRKPSPEPEGEGGSVKMNGEGQPWLPAAESLKISTMASPSFISPPSTVSPHSNRTTPPEAAQNGQSPMAALILVADNAGGNHASKDANQVHSTTRRNSSSPPSPSSMNQRRMAPRDVPSQIPSGGTSSHAGMEQGHPQSIPDSSIPNSIPLCCTLCHERLEDTHFVQCPSVPSHKFCFPCSRQSIKQQGSSGEVYCPSGEKCPLVGSNVPWAFMQGEIATILAGDVKVKKERDS
Donor tissue: neurula