ORFeome > itgb1 – XORFeome 2.0

itgb1 – XORFeome 2.0

General Information

Species: Xenopus tropicalis integrin beta 1 (fibronectin receptor beta), mRNA (cDNA clone MGC:76178 IMAGE:5335695), complete cds
Gene Symbol: itgb1
Gene ID: 394767
ORF gb_acc: MG132689
ORF ID: 9979

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC063214

Library Location

Plate ID: GDExt11001
Well Location: E06

EST Sequences

Clone: MGC:76178 IMAGE:5335695
Trimmed Sequence: ATGGCCCGTTATTCAGTATTGACGTTTGGATTACTTACTTGTTTGGCTTTGTGCATAAATGCCCAGCAAGGTGGGACAGAATGTCTAAAAGCAAATGCCAAATCATGTGGAGAATGTATTCAAGCCGGGCCCAACTGCGGCTGGTGCACTAAAGTGAACTTCTTACAAGAAGGAGAGCCCACGTCAGCACGTTGTGACGATTTGGCTGCTTTGAAAAACAAAGGCTGCCCTGAAGAAGACATCCAAAACCCCAGGGGACGTAAACAAAAGCTAAAAGATATCCCAATAACAAACAAAGGGAAAGGAGAACGTATGGACCCTGCAAACATCACCCAAATCCGACCTCAACAACTGGTATTCGAACTGCGATCAGGTGAACCCCAGACATTTAATTTGACATTCAGAAGAGCAGAAGACTATCCAATTGACCTGTACTATCTTATGGACCTCTCATTTTCTATGAAAGATGACTTGGAGAACGTTAAAAGCCTTGGAACAGCACTAATGACAGAAATGGAGAAAATTACTTCAGATTTCCGGATAGGTTTTGGCTCTTTTGTGGAAAAAACAGTCATGCCCTACATAAGCACCACTCCTGCCAAGCTTATTAACCCATGCACAAGTGATCAGAATTGCACCAGCCCATTCAGCTATAAAAATGTCCTCAACCTCACTAGCGACGGAAAGTTGTTTAACGACCTGGTAGGCAAGCAGCAGATCTCCGGTAACTTGGATTCTCCCGAGGGAGGCTTTGATGCAATTATGCAGGTTGCGGTCTGTGGTGAGCAAATTGGTTGGAGAAATGTCACACGCTTGCTGGTCTTCTCAACTGACGCAGGATTCCATTTTGCCGGAGATGGAAAATTAGGCGGCATTGTATTGCCAAATGATGGCAAATGTCATTTGCATGGGAACATGTACACAATGAGCCACTATTATGACTATCCCTCAATTGCTCACCTAGTTCAGAAACTTAGTGAAAACAACATTCAGACCATTTTTGCTGTTACAGAGGATTTCCAGCCAGTCTACCAGGAGCTGAAAAATCTGATACCAAAATCAGCTGTGGGAACCTTGTCGTCAAATTCCAGCAATGTGATTCAACTGATTATTGACTCCTATAATTCTCTTTCCTCTGAACTTATTTTGGAAAACAGCAAATTGCCAGAGGGTGTAACAATCAGCTATAAATCATTCTGTAAGAATGGAGTCAAGGGAACTGGGGAGGATGGAAGGAAATGTTCAAACATTTCTATTGGAGATCAGGTGGAATTTGAAATTAGTGTGACAGCTCACAAGTGCCCCAAAAAAGGACAAGCGGAATCCATAAAAATCAAACCACTTGGATTTACCGAAGAAGTAGAGATTGTTCTCCAGTTCATCTGTGAATGTGATTGCCAGGAAAAAGGGACGCCCAACAGCCCTGAATGTCATCATGGAAATGGAACATTCGAATGTGGTGCCTGCAGATGTAATGAGGGGCGCATTGGGAAGGAGTGTGAATGCAGCACCGATGAAGTAAACAGCGAAGATATGGACGCTTATTGTCGAAGAGAAAATAGCTCTGAAATCTGCAGTAACAACGGGGACTGTATATGCGGCCAGTGTGTGTGCAAAAAACGGGACAATCCCAATGAAGTTTACTCCGGCAAGTACTGTGAATGCGACAACTTCAACTGTGACAGATCCAATGGGCTGATTTGTGGAGGTAAAGGCGTGTGCAAGTGTCGAGTATGTGAATGTTTCCCCAATTACTCCGGCAGTGCTTGTGACTGCTCAGAGGATACCTCGACTTGTATGGCAAAAAATGGCCAGATATGTAACGGGAGAGGAATATGTGACTGTGGAAGGTGTAAATGTACAGATCCTAAATTCCAAGGACCAACCTGTGAACTGTGTCAGACCTGCGTTGGTGTTTGTACGGAGCACAAAGAATGTGTCCAGTGCCGAGCTTTCCAGAAAGGAGAGAAGCAAGAAGTATGCCTGGAGCAGTGCATGCACTTTAACATCTCTTTAGTGGAAAGTCGGGAAGACTTGCCCCAGCCAGGCCAGGCAGAAGCCCTCACACACTGTAAGGAAAAGGATGCAGAAGACTGCTGGTTTTACTTCACGTATTCAGTCGATTCAAAGAATGAAGTTCTGGTGCATGTGGTGAAGGAGCCAGAGTGTCCCAGCGGTCCTGACATCATTCCTATTGTCGCCGGTGTGGTTGCTGGCATTGTGCTCATCGGACTGGCACTGTTGCTCATATGGAAACTGCTTATGATCATTCACGACAGAAGGGAGTTTGCCAAGTTCGAGAAGGAGAAAATGAACGCTAAATGGGACACTGGCGAAAATCCCATCTACAAGAGCGCCGTGACAACCGTGGTGAATCCTAAATATGAGGGAAAATGA
Full Trace Sequence: gacctgcctgggctcggaggccgcaatctgaggcagcgcttagtctgtgcgattcagcccggcagggcgccgctcctgggatccaagggccccacgccaaagatggcccgttattcagtattgacgtttggattacttacttgtttggctttgtgcataaatgcccagcaaggtgggacagaatgtctaaaagcaaatgccaaatcatgtggagaatgtattcaagccgggcccaactgcggctggtgcactaaagtgaacttcttacaagaaggagagcccacgtcagcacgttgtgacgatttggctgctttgaaaaacaaaggctgccctgaagaagacatccaaaaccccaggggacgtaaacaaaagctaaaagatatcccaataacaaacaaagggaaaggagaacgtatggaccctgcaaacatcacccaaatccgacctcaacaactggtattcgaactgcgatcaggtgaaccccagacatttaatttgacattcagaagagcagaagactatccaattgacctgtactatcttatggacctctcattttctatgaaagatgacttggagaacgttaaaagccttggaacagcactaatgacagaaatggagaaaattacttcagatttccggataggttttggctcttttgtggaaaaaacagtcatgccctacataagcaccactcctgccaagcttattaacccatgcacaagtgatcagaattgcaccagcccattcagctataaaaatgtcctcaacctcactagcgacggaaagttgtttaacgacctggtaggcaagcagcagatctccggtaacttggattctcccgagggaggctttgatgcaattatgcaggttgcggtctgtggtgagcaaattggttggagaaatgtcacacgcttgctggtcttctcaactgacgcaggattccattttgccggagatggaaaattaggcggcattgtattgccaaatgatggcaaatgtcatttgcatgggaacatgtacacaatgagccactattatgactatccctcaattgctcacctagttcagaaacttagtgaaaacaacattcagaccatttttgctgttacagaggatttccagccagtctaccaggagctgaaaaatctgataccaaaatcagctgtgggaaccttgtcgtcaaattccagcaatgtgattcaactgattattgactcctataattctctttcctctgaacttattttggaaaacagcaaattgccagagggtgtaacaatcagctataaatcattctgtaagaatggagtcaagggaactggggaggatggaaggaaatgttcaaacatttctattggagatcaggtggaatttgaaattagtgtgacagctcacaagtgccccaaaaaaggacaagcggaatccataaaaatcaaaccacttggatttaccgaagaagtagagattgttctccagttcatctgtgaatgtgattgccaggaaaaagggacgcccaacagccctgaatgtcatcatggaaatggaacattcgaatgtggtgcctgcagatgtaatgaggggcgcattgggaaggagtgtgaatgcagcaccgatgaagtaaacagcgaagatatggacgcttattgtcgaagagaaaatagctctgaaatctgcagtaacaacggggactgtatatgcggccagtgtgtgtgcaaaaaacgggacaatcccaatgaagtttactccggcaagtactgtgaatgcgacaacttcaactgtgacagatccaatgggctgatttgtggaggtaaaggcgtgtgcaagtgtcgagtatgtgaatgtttccccaattactccggcagtgcttgtgactgctcagaggatacctcgacttgtatggcaaaaaatggccagatatgtaacgggagaggaatatgtgactgtggaaggtgtaaatgtacagatcctaaattccaaggaccaacctgtgaactgtgtcagacctgcgttggtgtttgtacggagcacaaagaatgtgtccagtgccgagctttccagaaaggagagaagcaagaagtatgcctggagcagtgcatgcactttaacatctctttagtggaaagtcgggaagacttgccccagccaggccaggcagaagccctcacacactgtaaggaaaaggatgcagaagactgctggttttacttcacgtattcagtcgattcaaagaatgaagttctggtgcatgtggtgaaggagccagagtgtcccagcggtcctgacatcattcctattgtcgccggtgtggttgctggcattgtgctcatcggactggcactgttgctcatatggaaactgcttatgatcattcacgacagaagggagtttgccaagttcgagaaggagaaaatgaacgctaaatgggacactggcgaaaatcccatctacaagagcgccgtgacaaccgtggtgaatcctaaatatgagggaaaatgaggaagaagtagtgtaaatgccacaacactgtatgcaagacagcattctttgtactcccaagaaggtagcaaaagggccataccccagtgacgccacgatagatatcatggaagaatcgcgtacagttaacagaaatccagaaacatgtgctcgcgagagcataacgtctaattggtgccacacgaccgtcagaacattttattctccataatgttttgttgtcccttgatcttgggttcattcaagaccgcagataatgaagtcctcccgaggacgcaaggtcacatcgtgcctttttcatccccttcctcttgtacaaaaaaatgggatttttttcttttttgtttgttttttttgggtaagtgtgtgtgtgcctgtgtgcgtccgtctggaagggggcaggtttgatctcgctcagagctttgccaatcagagtattattatgtatttctttcgccattggacgatcagggctggaatttacagacaggccaatagtaacattgcatacctcagactctctctctgcatgatcagcaggtctgtatgcatctcctcgtgccaagccacttttgaataagtgagaaaaggcaaattatttgacacataatgtacataataaatacccggtccgtgagcatgcttctatagatggtaaattccagctctgtgtcattttgctgcctgactcctgtacctaaccaaaaatcacctcctcatagggccttaaatctccccatgtcctattatatgtatgttctttggaaatttggtgcttccttttgccttaatcatttcattctgccatcaatttatgtacatttgctatctacctacaaattgtccctccccctggttatttacacccaagcgttctcatgtacagcctttaaacaaagacgttctaacagcgtgccattcagcgtatatcagtctcggaccattctcattgcctctgtcccatatttgtcacaatcttgtttttaagtgcctttttattttagcaggttttcactttttacaatactgttaacggaaagttatttattaaataaaaacgacttaaaaaatcttaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MARYSVLTFGLLTCLALCINAQQGGTECLKANAKSCGECIQAGPNCGWCTKVNFLQEGEPTSARCDDLAALKNKGCPEEDIQNPRGRKQKLKDIPITNKGKGERMDPANITQIRPQQLVFELRSGEPQTFNLTFRRAEDYPIDLYYLMDLSFSMKDDLENVKSLGTALMTEMEKITSDFRIGFGSFVEKTVMPYISTTPAKLINPCTSDQNCTSPFSYKNVLNLTSDGKLFNDLVGKQQISGNLDSPEGGFDAIMQVAVCGEQIGWRNVTRLLVFSTDAGFHFAGDGKLGGIVLPNDGKCHLHGNMYTMSHYYDYPSIAHLVQKLSENNIQTIFAVTEDFQPVYQELKNLIPKSAVGTLSSNSSNVIQLIIDSYNSLSSELILENSKLPEGVTISYKSFCKNGVKGTGEDGRKCSNISIGDQVEFEISVTAHKCPKKGQAESIKIKPLGFTEEVEIVLQFICECDCQEKGTPNSPECHHGNGTFECGACRCNEGRIGKECECSTDEVNSEDMDAYCRRENSSEICSNNGDCICGQCVCKKRDNPNEVYSGKYCECDNFNCDRSNGLICGGKGVCKCRVCECFPNYSGSACDCSEDTSTCMAKNGQICNGRGICDCGRCKCTDPKFQGPTCELCQTCVGVCTEHKECVQCRAFQKGEKQEVCLEQCMHFNISLVESREDLPQPGQAEALTHCKEKDAEDCWFYFTYSVDSKNEVLVHVVKEPECPSGPDIIPIVAGVVAGIVLIGLALLLIWKLLMIIHDRREFAKFEKEKMNAKWDTGENPIYKSAVTTVVNPKYEGK
Donor tissue: tailbud