ORFeome > itgb1bp3 – XORFeome 2.0

itgb1bp3 – XORFeome 2.0

General Information

Species: Xenopus tropicalis integrin beta 1 binding protein 3, mRNA (cDNA clone MGC:79789 IMAGE:6986059), complete cds
Gene Symbol: itgb1bp3
Gene ID: 493441
ORF gb_acc: MG133765
ORF ID: 11334

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC080978

Library Location

Plate ID: GDExt11013
Well Location: B08

EST Sequences

Clone: MGC:79789 IMAGE:6986059
Trimmed Sequence: ATGAAGATCATCGTGGGGATCGGAGGCGTAACCAACGGTGGAAAGACAACACTCACCAACAAACTGATTAATGCTTTGCCGAACTGCTGTGTGGTACACCAGGATGACTTTTTCAAGCCCCAAGACAAGATAGAAGTTCAAGATGGATTTAAGCAGTATGATGTTATCACAGCTTTAGATATGGAAGCTATGATGAGTACGATTGATGGCTGGCGAAAAGATCCTGCCAAGTTTGAACGCTCCCATGGTATCAACAACGCATTAGACTCTGAGACACCACAAGATACCGAGGAGAATGAAAGCCTTCATGTTCTTATTGTAGAAGGATTTCTCCTTTACACCTACAAACCACTTATTGATCTGTTCACCAAATGCTATTTCCTTTCTGTACCCTACGATGAATGCAAGAGAAGAAGGAGCTCAAGAAACTACACTGTTCCAGATCCACCGGGACTGTTTGATGGCCATGTGTGGCCTATGTACATAAAGCACAAGAATATAATGGAAGAATTAAACGTTAATGTTGAGCAACTGGATGGGACAAATACCAGGGAAGAGTTGTTCAACAGAGTGTATGGAGACATGCTGGATCTTATAAACAGCAAGGAATGA
Full Trace Sequence: tttacattcatttgcttgtttaacttggcgtgacaaggacacaacatgaagatcatcgtggggatcggaggcgtaaccaacggtggaaagacaacactcaccaacaaactgattaatgctttgccgaactgctgtgtggtacaccaggatgactttttcaagccccaagacaagatagaagttcaagatggatttaagcagtatgatgttatcacagctttagatatggaagctatgatgagtacgattgatggctggcgaaaagatcctgccaagtttgaacgctcccatggtatcaacaacgcattagactctgagacaccacaagataccgaggagaatgaaagccttcatgttcttattgtagaaggatttctcctttacacctacaaaccacttattgatctgttcaccaaatgctatttcctttctgtaccctacgatgaatgcaagagaagaaggagctcaagaaactacactgttccagatccaccgggactgtttgatggccatgtgtggcctatgtacataaagcacaagaatataatggaagaattaaacgttaatgttgagcaactggatgggacaaataccagggaagagttgttcaacagagtgtatggagacatgctggatcttataaacagcaaggaatgactgagaggaacgcgtggcctttgaatgattgtcaatgccttttggattttaacttatcgccttattttctatttttgcatataaagatttttgtctggattattaacaagttaagttgctcttcagtgaatgagacatatttaaataaactgtggctcctgccagcataagctaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MKIIVGIGGVTNGGKTTLTNKLINALPNCCVVHQDDFFKPQDKIEVQDGFKQYDVITALDMEAMMSTIDGWRKDPAKFERSHGINNALDSETPQDTEENESLHVLIVEGFLLYTYKPLIDLFTKCYFLSVPYDECKRRRSSRNYTVPDPPGLFDGHVWPMYIKHKNIMEELNVNVEQLDGTNTREELFNRVYGDMLDLINSKE
Donor tissue: tadpole