ORFeome > itln1 – XORFeome 2.0

itln1 – XORFeome 2.0

General Information

Species: Xenopus tropicalis intelectin 1 (galactofuranose binding), mRNA (cDNA clone MGC:76330 IMAGE:5380579), complete cds
Gene Symbol: itln1
Gene ID: 394526
ORF gb_acc: MG132951
ORF ID: 10325

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC061445

Library Location

Plate ID: GDExt11003
Well Location: A10

EST Sequences

Clone: MGC:76330 IMAGE:5380579
Trimmed Sequence: ATGTTGGTATATAGCCTGTTGGTTTTTGCCCTTGGATTTCCAGCAGGGCACGCTGGTTCATGTGAACAAGCTTCAATTTCTGAAAAGAAGGAAAAAATTTTGAACCTTCTGGCATGCTGGACAGAGGATAAGACAGACAACAGCGGGTCCCGTTTCAGTGGCTCTCCAACTGGTGATATGAGCTATGGATACAGGAGCTGCAATGAAATCAAGAGCTCAGACCCATCAGCTCCTGACGGCATATACACACTGGCAACTGAGCATGGCGAGTCCTATCAAACCTTCTGTGATATGACAACTAATGGGGGTGGATGGACCTTGGTGGCCAGTGTCCATGAGAACAACATGTTTGGAAAATGCACTGTGGGTGATCGCTGGTCCACACAGCAGGGGAATACTTTACAAAATCCAGAAGGCGATGGAAACTGGGCAAACTATGCCACATTTGGGCTACCTGAAGGAGCTACAAGTGATGACTATAAGAATCCTGGCTATTATGACATCCAGGCTAAAAATCTGGCTTTGTGGCATGTGCCCAACAACACTCCAATGTTTAACTGGAGGAACTCATCAATTCTGAGATATCGCACACAAAATAGCTTTTTTACTGAGGAGGGAGGAAATTTGTTTGAACTGTACAAGAAATATCCAGTAAAGTATGATATTGGTAAATGTCTAGCAGACAATGGACCCGCTGTGCCTGTAGTCTATGACCTTGGAAGTGCAGAGAAGACTTCATCTCTCTACTCACCAAATGGAAGAAATGAGTTTACAGCGGGCTTTGTCCAGTTCCGAGTTGTCAACACTGAGAAGGCTGCACTTGCTCTTTGTCCAGGGGTGAAGGTGAAGGGCTGCAATGCAGAACATCACTGCATTGGAGGAGGTGGTTACTTCCCCGAAGGAAGCCCCAGACAGTGTGGAGACTTTTCAGCCTTTGATTGGGATGGCTATGGGACACACGCAGGATGGAGTGCAAGCAAAGAGATTACCGAGGCAGCTGTGCTGCTCTTATACCGTTAA
Full Trace Sequence: aaagggcagcctctgaaatgggcaagatgttggtatatagcctgttggtttttgcccttggatttccagcagggcacgctggttcatgtgaacaagcttcaatttctgaaaagaaggaaaaaattttgaaccttctggcatgctggacagaggataagacagacaacagcgggtcccgtttcagtggctctccaactggtgatatgagctatggatacaggagctgcaatgaaatcaagagctcagacccatcagctcctgacggcatatacacactggcaactgagcatggcgagtcctatcaaaccttctgtgatatgacaactaatgggggtggatggaccttggtggccagtgtccatgagaacaacatgtttggaaaatgcactgtgggtgatcgctggtccacacagcaggggaatactttacaaaatccagaaggcgatggaaactgggcaaactatgccacatttgggctacctgaaggagctacaagtgatgactataagaatcctggctattatgacatccaggctaaaaatctggctttgtggcatgtgcccaacaacactccaatgtttaactggaggaactcatcaattctgagatatcgcacacaaaatagcttttttactgaggagggaggaaatttgtttgaactgtacaagaaatatccagtaaagtatgatattggtaaatgtctagcagacaatggacccgctgtgcctgtagtctatgaccttggaagtgcagagaagacttcatctctctactcaccaaatggaagaaatgagtttacagcgggctttgtccagttccgagttgtcaacactgagaaggctgcacttgctctttgtccaggggtgaaggtgaagggctgcaatgcagaacatcactgcattggaggaggtggttacttccccgaaggaagccccagacagtgtggagacttttcagcctttgattgggatggctatgggacacacgcaggatggagtgcaagcaaagagattaccgaggcagctgtgctgctcttataccgttaatgtgatgcaaaatgcttttccattctgtcagatgtttgtaaaattacaaaaataaaagaactatgaactaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MLVYSLLVFALGFPAGHAGSCEQASISEKKEKILNLLACWTEDKTDNSGSRFSGSPTGDMSYGYRSCNEIKSSDPSAPDGIYTLATEHGESYQTFCDMTTNGGGWTLVASVHENNMFGKCTVGDRWSTQQGNTLQNPEGDGNWANYATFGLPEGATSDDYKNPGYYDIQAKNLALWHVPNNTPMFNWRNSSILRYRTQNSFFTEEGGNLFELYKKYPVKYDIGKCLADNGPAVPVVYDLGSAEKTSSLYSPNGRNEFTAGFVQFRVVNTEKAALALCPGVKVKGCNAEHHCIGGGGYFPEGSPRQCGDFSAFDWDGYGTHAGWSASKEITEAAVLLLYR
Donor tissue: tadpole