ORFeome > kbtbd10 – XORFeome 2.0

kbtbd10 – XORFeome 2.0

General Information

Species: Xenopus tropicalis kelch repeat and BTB (POZ) domain containing 10, mRNA (cDNA clone MGC:75722 IMAGE:5380907), complete cds
Gene Symbol: kbtbd10
Gene ID: 394822
ORF gb_acc: MG132924
ORF ID: 10290

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC063333

Library Location

Plate ID: GDExt11003
Well Location: F10

EST Sequences

Clone: MGC:75722 IMAGE:5380907
Trimmed Sequence: ATGGATCCCACCGGGGAAATAAAGGATGAACTTAGGCTTTACCAGTCGACTCTTCTTCAGGATGGCCTGAAGGAGCTTCTTGATGAAAATAAGTTTGTAGATTGCTTCTTAAAGGCTGGCAGCAAAAGCCTTCCTTGCCATAGGCTTATCCTTGCTGCCTGCAGCCCTTATTTCCGGGAGTTCTTCCTATCCGATGAAAGTGAGGAGAAGAAAAAAAATATGGAATTGGACAATGTCGAACCAAGCACAATGGAAGCCATCCTTAAATATCTATATTCAGCTGATATTGACCTTAATGACGGCAACGTGCAAGATATTTTTGCTTTGGCTAGTCGCTTCCAAATCCCATCTGTTTTCACGGTATGTGTGACTTATCTTCAGAGAAGGCTCTCCCCTGCTAACTGTTTGGCCATCTTTAGATTGGGCCTTCTATTAGATTGTCCACGCCTGGCCGTTACTGCCCGAGATTATGTCTGTGATCGATTCATGCAGATCTGCAATGAAGAAGACTTCCTGCAGCTTGCGCCACATGAGTTAATCGCAGTCATTTCCAGTGATGGCCTAAATGTGGAGAAGGAAGAGCTGGTGTTTGAGGCCGTGATGAAATGGGTACAAACAGACAAGGAAAACAAAACAAAGAGCCTCTCTGATGTCTTCGACTGCATTCGATTTCGCTTGATGCCTGAAAAATATTTTACCGATAAGGTAGAAAAGCATGACCTCATCAAAGCCAATCCTGATATAGTTAAAAAAGTTAAGGTTATTAAGGATGCCTTTGCTGGCAAACTCCCCGAGGGCTCCAAAGGCAAAGAGAATTCGGGCAAAGAAGGAGAGGATGGCGACGTTGGAGATGAAGATTTGCTCCCTGGGTATCTGAATGACATTCCCAGACACGGTATGTTTGTGAAAGATCTGATGCTTTTGGTTAGCGACACGGCGGCTGTGGCTTACGACCCTCTTGAAAATGAGTGCTTCTTGGTCGGACTGTCAGAACAGATTCCAAGAAACCATTCCAGCATAGTCACCAAATCCAACCAAGTCTACGTCATCGGTGGCCTCTATGTGGATGAAGAGAACAAAGATCAGCCATTGCATTCATATTTCTTTCAGCTTGACAGCATCGCTGGTGACTGGATTGGACTCCCCCCACTCCCATCTGCGAGATGCCTGTTCGGCCTGGGTGAAGCAGATGACTGCGTTTATGCCATTGCTGGCAGGGACCTGCAGTCGGAAGAGTCGCTAGATTCTGTGTTCTGCTACGATAGCAAGGCCGTAGCTTGGACAGAAGTGAAGAAGCTCCCGATCAAGGTCTATGGGCATTCTGCAGTGTCACACAATAGCCAAATCTATTGTCTAGGTGGAAAAACAGAGGACAAGAAATGCACTGGCAGAATGTTTGTATTCAACCCAAAGAAGGGAGAATGGAAAGACCTGCCACCCATGAGAACTTCCCGCTCCATGTTTGGGGTCACCGTGCACAAAGGGAAAATATTCGTTGTCGGGGGTGTCACAGAGGAAGGCCTGACCGCATCTGTGGAAGCCTATGATATTGCCACTAACAAGTGGGAAACACTTGCCGAATTCCCCCAGGAGAGAAGTTCTATAAATTTGGTCAGCGTGGGCGGGTCGCTATATGCCGTGGGAGGATTTGCTATGATTCAGCTGGAATCAAAGGAGTTTGCACCTACTGAAGTCACTGATGTGTGGAAATACGAAGATGATAAGAAGGAATGGAGCGGGATGCTGAAGGAGCTGCGATACGCCGCAGGAGCCACCTGCCTGGACACACGTCTTAACCTTTTCAAACTGACCAAGTTGTGA
Full Trace Sequence: cttgggagctgctagaagcagaggcctctccgtttctcctgcaaacgcctgctcttcaggaaacaaaaaaaaatggatcccaccggggaaataaaggatgaacttaggctttaccagtcgactcttcttcaggatggcctgaaggagcttcttgatgaaaataagtttgtagattgcttcttaaaggctggcagcaaaagccttccttgccataggcttatccttgctgcctgcagcccttatttccgggagttcttcctatccgatgaaagtgaggagaagaaaaaaaatatggaattggacaatgtcgaaccaagcacaatggaagccatccttaaatatctatattcagctgatattgaccttaatgacggcaacgtgcaagatatttttgctttggctagtcgcttccaaatcccatctgttttcacggtatgtgtgacttatcttcagagaaggctctcccctgctaactgtttggccatctttagattgggccttctattagattgtccacgcctggccgttactgcccgagattatgtctgtgatcgattcatgcagatctgcaatgaagaagacttcctgcagcttgcgccacatgagttaatcgcagtcatttccagtgatggcctaaatgtggagaaggaagagctggtgtttgaggccgtgatgaaatgggtacaaacagacaaggaaaacaaaacaaagagcctctctgatgtcttcgactgcattcgatttcgcttgatgcctgaaaaatattttaccgataaggtagaaaagcatgacctcatcaaagccaatcctgatatagttaaaaaagttaaggttattaaggatgcctttgctggcaaactccccgagggctccaaaggcaaagagaattcgggcaaagaaggagaggatggcgacgttggagatgaagatttgctccctgggtatctgaatgacattcccagacacggtatgtttgtgaaagatctgatgcttttggttagcgacacggcggctgtggcttacgaccctcttgaaaatgagtgcttcttggtcggactgtcagaacagattccaagaaaccattccagcatagtcaccaaatccaaccaagtctacgtcatcggtggcctctatgtggatgaagagaacaaagatcagccattgcattcatatttctttcagcttgacagcatcgctggtgactggattggactccccccactcccatctgcgagatgcctgttcggcctgggtgaagcagatgactgcgtttatgccattgctggcagggacctgcagtcggaagagtcgctagattctgtgttctgctacgatagcaaggccgtagcttggacagaagtgaagaagctcccgatcaaggtctatgggcattctgcagtgtcacacaatagccaaatctattgtctaggtggaaaaacagaggacaagaaatgcactggcagaatgtttgtattcaacccaaagaagggagaatggaaagacctgccacccatgagaacttcccgctccatgtttggggtcaccgtgcacaaagggaaaatattcgttgtcgggggtgtcacagaggaaggcctgaccgcatctgtggaagcctatgatattgccactaacaagtgggaaacacttgccgaattcccccaggagagaagttctataaatttggtcagcgtgggcgggtcgctatatgccgtgggaggatttgctatgattcagctggaatcaaaggagtttgcacctactgaagtcactgatgtgtggaaatacgaagatgataagaaggaatggagcgggatgctgaaggagctgcgatacgccgcaggagccacctgcctggacacacgtcttaaccttttcaaactgaccaagttgtgaggctgcgtcgctgcgacatgaggttgtgtcctcagctttctcttcatctctgctacttgtgtaaaaaaaattaaaaaacacaaaaaattgtacagacatttctaggtaaattaataaaactatgaccatgtatggaaaaaaaaaaaaaaaaaa
Translation: MDPTGEIKDELRLYQSTLLQDGLKELLDENKFVDCFLKAGSKSLPCHRLILAACSPYFREFFLSDESEEKKKNMELDNVEPSTMEAILKYLYSADIDLNDGNVQDIFALASRFQIPSVFTVCVTYLQRRLSPANCLAIFRLGLLLDCPRLAVTARDYVCDRFMQICNEEDFLQLAPHELIAVISSDGLNVEKEELVFEAVMKWVQTDKENKTKSLSDVFDCIRFRLMPEKYFTDKVEKHDLIKANPDIVKKVKVIKDAFAGKLPEGSKGKENSGKEGEDGDVGDEDLLPGYLNDIPRHGMFVKDLMLLVSDTAAVAYDPLENECFLVGLSEQIPRNHSSIVTKSNQVYVIGGLYVDEENKDQPLHSYFFQLDSIAGDWIGLPPLPSARCLFGLGEADDCVYAIAGRDLQSEESLDSVFCYDSKAVAWTEVKKLPIKVYGHSAVSHNSQIYCLGGKTEDKKCTGRMFVFNPKKGEWKDLPPMRTSRSMFGVTVHKGKIFVVGGVTEEGLTASVEAYDIATNKWETLAEFPQERSSINLVSVGGSLYAVGGFAMIQLESKEFAPTEVTDVWKYEDDKKEWSGMLKELRYAAGATCLDTRLNLFKLTKL
Donor tissue: tadpole