ORFeome > krt – XORFeome 2.0

krt – XORFeome 2.0

General Information

Species: Xenopus tropicalis keratin, mRNA (cDNA clone MGC:69554 IMAGE:5378980), complete cds
Gene Symbol: krt
Gene ID: 448098
ORF gb_acc: MG133351
ORF ID: 10854

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC074628

Library Location

Plate ID: GDExt11008
Well Location: E09

EST Sequences

Clone: MGC:69554 IMAGE:5378980
Trimmed Sequence: ATGAGTTTCTCTACCCGAAGTGTCTCTCAATCCTCCCGCTATGGTGTTCTGGCATCACCCATGGTGAATCGGGCCCTAAGTGTGGCAGGGGGTGCCCAGACTGTCCGGATGTCCTCTGCTAAACTGACCAGCTCTGCGTTTGCCGGACCCTCTGCCCTTGATGTTAGCTCCTTTGGCAACAATGGCAAGGAGACAATGCAGAACCTGAACGATCGTCTGGCCAGCTACCTGGAACGGGTCCGTTCCTTGGAGCAAGCCAACCATGAGCTGGAGCTGAAGATCAGGGAGTACTGTGAGAAGAAAGCTGCCATTGGCTCCCCTGATGTTAGCGGTTACTATAACATCATCAACTTACTGCGCTCCCAGATCAATGATGCAAGCATTGACAATGCCAGGCTGGTCCTCCAGATCGACAATGCCAAGCTGGCAGCTGATGACTTCAAAATCAAGTATGAGTCAGAGCTGGCCATTAGGACTGGAGTCGAAAGCGACATTATCGGACTGCGCAGAGTCCTCGATGAGCTGACCCTCAATAAGACAGACCTGGAGTTGGAGATTGAAAGTCTGAAGGAAGAGCTGATTTACCTAAAGAAAAATCATGAAGAGGAACTTGCTGTTGCTAGGGCCAGTGCCAGAGGCCAAGTTGATGTACAGGTTGATTCTGCTCCTCCTGTTGACCTGTCACAGATCATGTCTGATGTGAGGGCTCAGTATGAAGGCATGATGGAGAAGAACCGCCAGGAGGTGGAAGCCTGGTACAGAGGACAGAGCGAAAATCTCAACAAAGAAGTTGCCACCAACACAGCTGCTCTCCAGACATCTAAGTCGCAGATTACAGACCTGAAGCGCACAATACAGAGCCTGGAGATTGAACTTCAGTCACTCTTGAGCATGAAAGGAGCACTGGAAGGCACTTTGGCAGAAACCGAGGCCCGATATGGAGCTGAGCTCAACCACCTTCAGGCCATGATCACGCAAATAGAATTAGACCTTCAAAACTTACGGTCAGATGCCGAGCGCCAGTCTTTGGAGTATAAGTTGTTGCTCGATGCCAAGACAAGGCTGGAAATGGAAATTTCCACCTACAGACGCCTGCTAGAAGGAGAAGACACCAGATTTTCCCAGACTGAAACACAGAAAGCTGTTACCATCGTCAGTAAGGAACAAAGCAAGAGCTCCATCAAAAAGGTGAAGACGGTGATCGAAGAAGTAGTCGACGGGAAAGTGGTCTCTTCTAGGGTCGAGGAAGTGACTGAGAAATCCTAA
Full Trace Sequence: actgctacattgggccccttaacattacagcatcacaatgagtttctctacccgaagtgtctctcaatcctcccgctatggtgttctggcatcacccatggtgaatcgggccctaagtgtggcagggggtgcccagactgtccggatgtcctctgctaaactgaccagctctgcgtttgccggaccctctgcccttgatgttagctcctttggcaacaatggcaaggagacaatgcagaacctgaacgatcgtctggccagctacctggaacgggtccgttccttggagcaagccaaccatgagctggagctgaagatcagggagtactgtgagaagaaagctgccattggctcccctgatgttagcggttactataacatcatcaacttactgcgctcccagatcaatgatgcaagcattgacaatgccaggctggtcctccagatcgacaatgccaagctggcagctgatgacttcaaaatcaagtatgagtcagagctggccattaggactggagtcgaaagcgacattatcggactgcgcagagtcctcgatgagctgaccctcaataagacagacctggagttggagattgaaagtctgaaggaagagctgatttacctaaagaaaaatcatgaagaggaacttgctgttgctagggccagtgccagaggccaagttgatgtacaggttgattctgctcctcctgttgacctgtcacagatcatgtctgatgtgagggctcagtatgaaggcatgatggagaagaaccgccaggaggtggaagcctggtacagaggacagagcgaaaatctcaacaaagaagttgccaccaacacagctgctctccagacatctaagtcgcagattacagacctgaagcgcacaatacagagcctggagattgaacttcagtcactcttgagcatgaaaggagcactggaaggcactttggcagaaaccgaggcccgatatggagctgagctcaaccaccttcaggccatgatcacgcaaatagaattagaccttcaaaacttacggtcagatgccgagcgccagtctttggagtataagttgttgctcgatgccaagacaaggctggaaatggaaatttccacctacagacgcctgctagaaggagaagacaccagattttcccagactgaaacacagaaagctgttaccatcgtcagtaaggaacaaagcaagagctccatcaaaaaggtgaagacggtgatcgaagaagtagtcgacgggaaagtggtctcttctagggtcgaggaagtgactgagaaatcctaaaaagaatcttaagaattaagagcctgtacctgagaaagggcagcagaagagttgaaataacatagtcttgaaggcaaccaagaagcttcattttaaaatgtagcctatacgtaaatgtttaatatgacagagaagatatgaaagcagaagagaaattagcaaaataaatgtcatgtaatgcaaacctaggctgtttgtgtttaactcttcctcagggacaatgcatccaaataaagaattttaagttaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MSFSTRSVSQSSRYGVLASPMVNRALSVAGGAQTVRMSSAKLTSSAFAGPSALDVSSFGNNGKETMQNLNDRLASYLERVRSLEQANHELELKIREYCEKKAAIGSPDVSGYYNIINLLRSQINDASIDNARLVLQIDNAKLAADDFKIKYESELAIRTGVESDIIGLRRVLDELTLNKTDLELEIESLKEELIYLKKNHEEELAVARASARGQVDVQVDSAPPVDLSQIMSDVRAQYEGMMEKNRQEVEAWYRGQSENLNKEVATNTAALQTSKSQITDLKRTIQSLEIELQSLLSMKGALEGTLAETEARYGAELNHLQAMITQIELDLQNLRSDAERQSLEYKLLLDAKTRLEMEISTYRRLLEGEDTRFSQTETQKAVTIVSKEQSKSSIKKVKTVIEEVVDGKVVSSRVEEVTEKS
Donor tissue: tailbud