ORFeome > krt18 – XORFeome 2.0

krt18 – XORFeome 2.0

General Information

Species: Xenopus tropicalis keratin 18, mRNA (cDNA clone MGC:75922 IMAGE:5383719), complete cds
Gene Symbol: krt18
Gene ID: 394541
ORF gb_acc: MG132981
ORF ID: 10361

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC061366

Library Location

Plate ID: GDExt11004
Well Location: B08

EST Sequences

Clone: MGC:75922 IMAGE:5383719
Trimmed Sequence: ATGAGTTACTCCCGCTCCGTGTATTCTTCCTCCTCTGTAGTAGGGGGGAGTCCCTACCGCTCCCTCAGCTCCGCACCCCGCTTTATACCCAGTAGCAGCGCCGCTAGTGTCCATGCTGGGGCAGGGGGCTCCGGGGCCCGGATCTCTGTATCTAGGGTATCCTCAGTGGGGTCAGGGTTTGGCGGTGGCTATAGCGGGGTATCTAATGTGAATCTGATCGGCGGGGGGCAGAATGAGAAGGAGACCATGCAGGACCTGAATGACCGCCTGGCATCCTATCTGGAGCGGGTCCGCAGCCTGGAGGCAGCCAATAAGAAACTGGAGGTGCAGATCCGCCAGCACACGGAAAAGAAGGGGCCCTCCAAGGACTGGAGTCCGTACTACAAGACTATTGAGGACTTAAGGAAACAGGTGTTTGATAGCACATTAGAGAACTCCCAGCTGGTCCTGCAGATTGACAACGCACGCCTTGCAGCTGACGACTTCAGAGTCAAGTATGAAGCAGAGATGGCTATCCGTATGTCTGTGGAAGGGGACATTACCGGGTTGCGCAAGCTTATAGACGACACCAACGTCAGCCGAATGAACTTGGAGAATGAGATTGAGTCCCTGAAGGAGGAGCTAATCTTCCTGAAGAAGAACCACCAGGATGATGTGACTGAACTACAGGCTCAGGTTGCAAGGTCTGCTGTAACTGTGGAGGTGGATGCCCCCAAATCACAAGACCTTGGCAAGATCATGACAGAACTTCGAGCACAATATGATGGACTGGCACAAAAGAACCGCGATGATGTTGAGAAGTGGTATCAGTCTAAGGTGGATGAGCACACAGTGCAAGTTAACCTAGATACAGAAGCGCTGCACTCTGCAAAGAGTTCCGTAACTGATCTGCGCCGCACTGTGCAGTCCCTAGAGATAGAGCTGGAGTCTCTGCGCAATCAGAAAGCAAGCTTAGAGGGCACACTCCACGACACAGAAGCACGTTATGCGATGGAGCTGGAGATGCTTGGGGGTACTGCCATGGCAATGGAGGCAGAGCTGGTACAAGTTCGCAGTGACTGCCAGAGACAGCAACAGGAGTACCAGGCTCTTCTTAACACAAAGATGAAGCTGGAAGCAGAAATCCATACCTACAGAAGGCTCCTGGAAGGAGACGGCAGTTTTGACCTCCAAGATGCTGTGCCAACGGTAACCACACAGACGGTAAAGAAAGTCATCACGACCACACAGAGGATTGTGGATGGGAAAGTGGTTTCGGAAAGCAATGATACTGAAGTCCTCAAGTCCTAA
Full Trace Sequence: ctccgcaccacttacctgcgcagccatgagttactcccgctccgtgtattcttcctcctctgtagtaggggggagtccctaccgctccctcagctccgcaccccgctttatacccagtagcagcgccgctagtgtccatgctggggcagggggctccggggcccggatctctgtatctagggtatcctcagtggggtcagggtttggcggtggctatagcggggtatctaatgtgaatctgatcggcggggggcagaatgagaaggagaccatgcaggacctgaatgaccgcctggcatcctatctggagcgggtccgcagcctggaggcagccaataagaaactggaggtgcagatccgccagcacacggaaaagaaggggccctccaaggactggagtccgtactacaagactattgaggacttaaggaaacaggtgtttgatagcacattagagaactcccagctggtcctgcagattgacaacgcacgccttgcagctgacgacttcagagtcaagtatgaagcagagatggctatccgtatgtctgtggaaggggacattaccgggttgcgcaagcttatagacgacaccaacgtcagccgaatgaacttggagaatgagattgagtccctgaaggaggagctaatcttcctgaagaagaaccaccaggatgatgtgactgaactacaggctcaggttgcaaggtctgctgtaactgtggaggtggatgcccccaaatcacaagaccttggcaagatcatgacagaacttcgagcacaatatgatggactggcacaaaagaaccgcgatgatgttgagaagtggtatcagtctaaggtggatgagcacacagtgcaagttaacctagatacagaagcgctgcactctgcaaagagttccgtaactgatctgcgccgcactgtgcagtccctagagatagagctggagtctctgcgcaatcagaaagcaagcttagagggcacactccacgacacagaagcacgttatgcgatggagctggagatgcttgggggtactgccatggcaatggaggcagagctggtacaagttcgcagtgactgccagagacagcaacaggagtaccaggctcttcttaacacaaagatgaagctggaagcagaaatccatacctacagaaggctcctggaaggagacggcagttttgacctccaagatgctgtgccaacggtaaccacacagacggtaaagaaagtcatcacgaccacacagaggattgtggatgggaaagtggtttcggaaagcaatgatactgaagtcctcaagtcctaactcttggaaacagattttcatgtccattgcatttcatttaataaacattccagaattctaaaaaaaaaaaaaaaataaaaaaaaaaaaaaaaaa
Translation: MSYSRSVYSSSSVVGGSPYRSLSSAPRFIPSSSAASVHAGAGGSGARISVSRVSSVGSGFGGGYSGVSNVNLIGGGQNEKETMQDLNDRLASYLERVRSLEAANKKLEVQIRQHTEKKGPSKDWSPYYKTIEDLRKQVFDSTLENSQLVLQIDNARLAADDFRVKYEAEMAIRMSVEGDITGLRKLIDDTNVSRMNLENEIESLKEELIFLKKNHQDDVTELQAQVARSAVTVEVDAPKSQDLGKIMTELRAQYDGLAQKNRDDVEKWYQSKVDEHTVQVNLDTEALHSAKSSVTDLRRTVQSLEIELESLRNQKASLEGTLHDTEARYAMELEMLGGTAMAMEAELVQVRSDCQRQQQEYQALLNTKMKLEAEIHTYRRLLEGDGSFDLQDAVPTVTTQTVKKVITTTQRIVDGKVVSESNDTEVLKS
Donor tissue: neurula