ORFeome > krt19 – XORFeome 2.0

krt19 – XORFeome 2.0

General Information

Species: Xenopus tropicalis keratin 19, mRNA (cDNA clone MGC:76282 IMAGE:5379368), complete cds
Gene Symbol: krt19
Gene ID: 394514
ORF gb_acc: MG132827
ORF ID: 10176

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC061624

Library Location

Plate ID: GDExt11003
Well Location: H04

EST Sequences

Clone: MGC:76282 IMAGE:5379368
Trimmed Sequence: ATGGCCTCTTACAGCGTTCGCCAGACAAGCTCCTCCAGCTCTTATAGAGGCTTAGGTGCCCCTATGGGAGCTGGCAGGATGTTCGCCAAAGCCCCAAGTGTCCATGGTGGGTATGGAGGCCAAGGTATCTCCGTGTCTTCTGCCAAGTTTGTTTCCTCTGGCATCGGTGGAGGCCTTGGCGGTGGCAGCTATGGTGGTGGGTTCAGCAGTGGATATGGTGCTGGTTCTGGATATGGTGCTGGTTCTGGATATGGTGCCGGGCTCAGCGTCAATGTATCCGGGGATGTCCTGCTGTCTGGCAACGAGAAGGAGACCATGCAGAATCTGAATGACCGTCTGGCAATGTACCTGGACAAGGTGCGCGCCCTGGAAGAAGCCAATTCAGGCTTGGAGCTGAAGATCCGGGAGTGGTATGAAAAACAGGGACCCAGCCCTTCCCGTGACTACAGCCATTACTTTGCTATCATCGAGGACCTCAGAGGCAAGATCCTTGACGCCACCGTCGACAATTCCAAGATCGTCCTGCAAATTGATAATGCCAGGCTGGCTGCGGATGACTTCAGAACCAAGTATGAGAACGAGTTGGCCCTCAGACAGAGTGTGGAATGTGATATCAATGGCCTACGCAAAGTCTTGGATGAGCTGACATTGTGTAGAACTGACCTGGAACACCAGATTGAAAGCTTGAAGGAAGAGTTGGCCTACCTGAAGAAGAACCATGAAGAGGAAATGAACGCAATGCGAGGACAAGTTGGCGGGCAAGTGAGCGTTGAAGTTGATGCGGCACCAACGGTGGATATGAACAAGAAACTGGCAGAAATGAGAGAACAGTATGAGCTCCTGGCAGAAAAGAACCGCAGAGACGCAGAGGCATGGTTCTTCTCACAGTCTGAGGAGTTGAACAAAGTAGTTGCAACTCATACAGAACAGATTCAGACCAGCAAATCGGAGATCACAGACCTACGACGCACAATCCAGGGCCTGGAGATAGAACTGCAGTCACAGCTCAGCATGAAAGCAGCCCTTGAAAACACACTTTCGGAAACAGAAGCCCGTTACGGAATGCAGCTAGCGCAGATACAGAACGTGATCGGCAGCATTGAAGCTCAGCTCGCAGACCTCCGGAGCGACATGGAGCGGCAGAACCACGAATACAAGTTGCTCATGGACATCAAGACCCGCCTGGAGAAAGAGATTAGCACCTACCGACAGCTGCTAGAAGGGCACGATGCACACTAA
Full Trace Sequence: ctggagtagagggaacagttacactcctgtgcatctcccagcctgccacagctaccatggcctcttacagcgttcgccagacaagctcctccagctcttatagaggcttaggtgcccctatgggagctggcaggatgttcgccaaagccccaagtgtccatggtgggtatggaggccaaggtatctccgtgtcttctgccaagtttgtttcctctggcatcggtggaggccttggcggtggcagctatggtggtgggttcagcagtggatatggtgctggttctggatatggtgctggttctggatatggtgccgggctcagcgtcaatgtatccggggatgtcctgctgtctggcaacgagaaggagaccatgcagaatctgaatgaccgtctggcaatgtacctggacaaggtgcgcgccctggaagaagccaattcaggcttggagctgaagatccgggagtggtatgaaaaacagggacccagcccttcccgtgactacagccattactttgctatcatcgaggacctcagaggcaagatccttgacgccaccgtcgacaattccaagatcgtcctgcaaattgataatgccaggctggctgcggatgacttcagaaccaagtatgagaacgagttggccctcagacagagtgtggaatgtgatatcaatggcctacgcaaagtcttggatgagctgacattgtgtagaactgacctggaacaccagattgaaagcttgaaggaagagttggcctacctgaagaagaaccatgaagaggaaatgaacgcaatgcgaggacaagttggcgggcaagtgagcgttgaagttgatgcggcaccaacggtggatatgaacaagaaactggcagaaatgagagaacagtatgagctcctggcagaaaagaaccgcagagacgcagaggcatggttcttctcacagtctgaggagttgaacaaagtagttgcaactcatacagaacagattcagaccagcaaatcggagatcacagacctacgacgcacaatccagggcctggagatagaactgcagtcacagctcagcatgaaagcagcccttgaaaacacactttcggaaacagaagcccgttacggaatgcagctagcgcagatacagaacgtgatcggcagcattgaagctcagctcgcagacctccggagcgacatggagcggcagaaccacgaatacaagttgctcatggacatcaagacccgcctggagaaagagattagcacctaccgacagctgctagaagggcacgatgcacactaaaacaggagggaagtgaggccactggtggagctgagacagcctgcaatcaagcccgtcttcattcattgcatagaaaacgcttacggagagtccatcacacagggatctgttacgctttccactgccagtgcaaatacccagcaccacgaagccaggaatccctaggaaatgatgatgctttagaaattcgcttgcaactcacttctttacatgcttcagctgtctcaataaataccaaatgtttgggccgtgcatttaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MASYSVRQTSSSSSYRGLGAPMGAGRMFAKAPSVHGGYGGQGISVSSAKFVSSGIGGGLGGGSYGGGFSSGYGAGSGYGAGSGYGAGLSVNVSGDVLLSGNEKETMQNLNDRLAMYLDKVRALEEANSGLELKIREWYEKQGPSPSRDYSHYFAIIEDLRGKILDATVDNSKIVLQIDNARLAADDFRTKYENELALRQSVECDINGLRKVLDELTLCRTDLEHQIESLKEELAYLKKNHEEEMNAMRGQVGGQVSVEVDAAPTVDMNKKLAEMREQYELLAEKNRRDAEAWFFSQSEELNKVVATHTEQIQTSKSEITDLRRTIQGLEIELQSQLSMKAALENTLSETEARYGMQLAQIQNVIGSIEAQLADLRSDMERQNHEYKLLMDIKTRLEKEISTYRQLLEGHDAH
Donor tissue: tailbud