ORFeome > lmnb1 – XORFeome 2.0

lmnb1 – XORFeome 2.0

General Information

Species: Xenopus tropicalis lamin B1, mRNA (cDNA clone MGC:75974 IMAGE:5384247), complete cds
Gene Symbol: lmnb1
Gene ID: 394806
ORF gb_acc: MG133008
ORF ID: 10395

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC063368

Library Location

Plate ID: GDExt11004
Well Location: G06

EST Sequences

Clone: MGC:75974 IMAGE:5384247
Trimmed Sequence: ATGGCCACCGCCACGCCAAGCGGCCCCAGGAGCTCCGGCCGTCGAAGCAGCATGAACACCCCGCTCAGCCCGACTCGTATCAGCCGCCTGCAGGAGAAAGTGGATCTGCAGGAGCTGAATGACCGCTTGGCCGTGTATATAGACAAGGTGCGCAGCCTGGAGAGCGAGAATAGCCTGCTCCATGTACAGGTCACCGAGCGGGAAGAGGTGCGGAGCCGGGAAGTGAGCGGCATCAAGGAGCTGTATGAGACCGAGCTGGCCGATGCCCGCAGGAGCCTGGATGACACTGCCCGGGAGAGAGCCCGCCTGCAGCTGGAGCTCAGTAAGATCTCCGTGGAACATGAGGATCTCCGTGCCAGTTTCTCAAAGAAAGAATCTGAATTGGAGTCGGCACAAGCTAGATTTAGAGAAACTGAAGCTCTTCTCAACTCAAAAAATGCTGCCCTTGCAACTACACAGAGTGAGAATAAGTCACTGCAAGGAGAGGTTGAGGACTTGAAAGCTGAAATTGGGCAGCTGGAATCCGCTTTGGCTCTTGCAAAGAAACAGCTTGAAGAAGAAATCTTGATAAAGGTGGATCTTGAAAACCGGTGTCAGTCCTTAATTGAGGAACTAGATTTCCGTAAAAACGTTTATGAAGAGGAAATAAAGGAGACTAGAAGAAGACACGAGACTCGCTTGGTGGAGGTTGATTCTGGCAAGCAAATAGAGTATGAACATAAACTATCACAAGCGCTTGCAGACATGAGGGAGCAACATGATTCTCAAGTTACACTGTACAAAGAAGAACTTGAACACACCTACCAATCTAAGCTGGAGAATGCACGACTATCCTCAGAAATGAACAGCTCTGCTGTAAATAGTACTCGAGAGGAGCTTATGGAAAGTCGATATCGAATTGACAGCCTCACATCCCAGCTTTCTGAGCTCCAAAAAGAGTCTAGAGCATGGCATGATCGGATGCAAGAACTAGAGGATATGCTGGCTAAGGAAAAGGACAACAGTCGCAAGATGCTTGCAGAGAGGGAGAGAGAAATGGCTGATATAAGAGATCAGATGCAGCAACAGCTTAATGACTATGAGCAGCTTCTAGATGTTAAATTGGCACTGGACATGGAAATAAGTGCATACAGGAAACTGCTGGAAGGTGAAGAGGAAAGGCTGAAGTTATCTCCGAGCCCCCCTTCCCGCGTGACTGTTTCTAGGGCTTCTTCAAGTCGCAGTGTGCGCACAGCTAAAGGCAAAAGAAAGAGAATTGATGTAGAAGAGTCTGAGGCCAGCAGCAGTGTTAGCATTTCTCATTCTGCATCCGCCACTGGGGATGTGAGCATCGAAGAAGTTGATGTGGATGGCAAATATATCAGACTGAAAAACAATTCAGAGCAGGATCATCCTTTAGGAGGTTGGGAACTGACCAGAACAATTGGAGAAGCATCTGTGAATTTCAAGTTTACCTCAAGATACGTACTTAAAGCAGGACAGACTGTCACAATCTGGGCTGCTGATGCAGGAGTTACAGCGAGTCCACCCTCTGACCTAATCTGGAAGAACCAGAACTCATGGGCAACAGGAGAAGATGTGAAGGTCATACTGAAGAATTCTCAGGGAGAGGACGTAGCACAGCGCACAACAGTATATACTACCACCATACCTGAAGAGGAGCTGGAAGAAGAAGAAGAAATGTTGGAGGAGATCACTAAAGAATCTCACTACTCTCAGCAGAAGTCAGGAAATAGAAACTGCGCCATCATGTAA
Full Trace Sequence: cgattgtatgcacattttacattttaatccttgcggggtttttcaattttaaaaagtacttgtattttagactgcgtgtgctactacgggtggagtgcccaggaggggaaagtttgcaggcagtgcggcggtgagtgtgtgtcggccgtcaagtataaaggagagtttagcctgagaaccggtaccgtcgctcttttatataaccattagaagaagccaactgtgcaatggccaccgccacgccaagcggccccaggagctccggccgtcgaagcagcatgaacaccccgctcagcccgactcgtatcagccgcctgcaggagaaagtggatctgcaggagctgaatgaccgcttggccgtgtatatagacaaggtgcgcagcctggagagcgagaatagcctgctccatgtacaggtcaccgagcgggaagaggtgcggagccgggaagtgagcggcatcaaggagctgtatgagaccgagctggccgatgcccgcaggagcctggatgacactgcccgggagagagcccgcctgcagctggagctcagtaagatctccgtggaacatgaggatctccgtgccagtttctcaaagaaagaatctgaattggagtcggcacaagctagatttagagaaactgaagctcttctcaactcaaaaaatgctgcccttgcaactacacagagtgagaataagtcactgcaaggagaggttgaggacttgaaagctgaaattgggcagctggaatccgctttggctcttgcaaagaaacagcttgaagaagaaatcttgataaaggtggatcttgaaaaccggtgtcagtccttaattgaggaactagatttccgtaaaaacgtttatgaagaggaaataaaggagactagaagaagacacgagactcgcttggtggaggttgattctggcaagcaaatagagtatgaacataaactatcacaagcgcttgcagacatgagggagcaacatgattctcaagttacactgtacaaagaagaacttgaacacacctaccaatctaagctggagaatgcacgactatcctcagaaatgaacagctctgctgtaaatagtactcgagaggagcttatggaaagtcgatatcgaattgacagcctcacatcccagctttctgagctccaaaaagagtctagagcatggcatgatcggatgcaagaactagaggatatgctggctaaggaaaaggacaacagtcgcaagatgcttgcagagagggagagagaaatggctgatataagagatcagatgcagcaacagcttaatgactatgagcagcttctagatgttaaattggcactggacatggaaataagtgcatacaggaaactgctggaaggtgaagaggaaaggctgaagttatctccgagccccccttcccgcgtgactgtttctagggcttcttcaagtcgcagtgtgcgcacagctaaaggcaaaagaaagagaattgatgtagaagagtctgaggccagcagcagtgttagcatttctcattctgcatccgccactggggatgtgagcatcgaagaagttgatgtggatggcaaatatatcagactgaaaaacaattcagagcaggatcatcctttaggaggttgggaactgaccagaacaattggagaagcatctgtgaatttcaagtttacctcaagatacgtacttaaagcaggacagactgtcacaatctgggctgctgatgcaggagttacagcgagtccaccctctgacctaatctggaagaaccagaactcatgggcaacaggagaagatgtgaaggtcatactgaagaattctcagggagaggacgtagcacagcgcacaacagtatatactaccaccatacctgaagaggagctggaagaagaagaagaaatgttggaggagatcactaaagaatctcactactctcagcagaagtcaggaaatagaaactgcgccatcatgtaataccagtgttccacattgtcctacagatctgagccttctggaagcacagcctatttttgtatcatgtacaatttacagtgtcagcattgactgccttaatatcttttctaccaatgtaatgcaggggcattttgtactagaatctgattttgcaaaaatgtgaattgactgtattttgtacactgtcctggacggtgggtcctggagtagatattttttgttacttgtggcaggaacatatctactgcctattgcttatccacttgtcacacttccaaggcactgtgtgcaaaggtgcttgcaggatctcagtctccctcacttccatcttttgtactgagttttattttctagcacaaaatcaagaattttaatttttttttttttttttttgaagctttgttttaattttttattgtggaaaaaaatacaacatgttttatcatgacattttaggtaactggtggggaaagtagctttttttatggggggggggggggtagcaaaacttttgtttgtttacataaacagaacaaaataaaagggggtttaaagaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MATATPSGPRSSGRRSSMNTPLSPTRISRLQEKVDLQELNDRLAVYIDKVRSLESENSLLHVQVTEREEVRSREVSGIKELYETELADARRSLDDTARERARLQLELSKISVEHEDLRASFSKKESELESAQARFRETEALLNSKNAALATTQSENKSLQGEVEDLKAEIGQLESALALAKKQLEEEILIKVDLENRCQSLIEELDFRKNVYEEEIKETRRRHETRLVEVDSGKQIEYEHKLSQALADMREQHDSQVTLYKEELEHTYQSKLENARLSSEMNSSAVNSTREELMESRYRIDSLTSQLSELQKESRAWHDRMQELEDMLAKEKDNSRKMLAEREREMADIRDQMQQQLNDYEQLLDVKLALDMEISAYRKLLEGEEERLKLSPSPPSRVTVSRASSSRSVRTAKGKRKRIDVEESEASSSVSISHSASATGDVSIEEVDVDGKYIRLKNNSEQDHPLGGWELTRTIGEASVNFKFTSRYVLKAGQTVTIWAADAGVTASPPSDLIWKNQNSWATGEDVKVILKNSQGEDVAQRTTVYTTTIPEEELEEEEEMLEEITKESHYSQQKSGNRNCAIM
Donor tissue: neurula