ORFeome > lmyc1 – XORFeome 2.0

lmyc1 – XORFeome 2.0

General Information

Species: Xenopus tropicalis lung carcinoma myc related oncogene 1, mRNA (cDNA clone MGC:89617 IMAGE:6995328), complete cds
Gene Symbol: lmyc1
Gene ID: 496561
ORF gb_acc: MG134335
ORF ID: 12019

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC084506

Library Location

Plate ID: GDExt11020
Well Location: H02

EST Sequences

Clone: MGC:89617 IMAGE:6995328
Trimmed Sequence: ATGGATTTTGGCTCCTGTAATAATCATTATTTCTATGATGTGGATATGAAGGAGGACTTTTATCGCTGCATTGCTCCAAGTGAAGACATATGGAAGAAGTTTGAGCTTGTGCCTGGCTTTCCTCTATCACCTGGGGGATGCCCAGGTGGTGGTGGAACAGACTGGGGAGCAGAACTAATGGATTTAGGGTGGGAGTCTCCTATGAAGTTAACTGGGTTAAGTTCTGTAGTCCTCCTGAGAGACTGCATGTGGAGTGGCTTCTCTACCCGAGAGAGACTAGAAAAGGTAATCCATGAGCGGCTGTCTACTGGGTCTCCTCGAGCAACAAATGCCCAAAAACCTGTAGCAGATAATGAAAACTCAGAACCTGGAGTAGACTCTATAGAACAGAATGCCACGCCTTTGGTTGTGCCGACACCCATTCCAGAAAAAGTACCCAATTCTTCTGGATCTGAGAGCACCAGTGATTCAGAAGAGGATGAGATTGATGTGGTAACCGTTGAGAAGAGAAAGTCCTATGGTGGGCGACAACCAGTGACTATCACTGTACGAGCTGATCCAACAGCAACTAAACTCTTTCATATATCCATACACCAGCAACAACACAACTATGCAGCCCGCCTTCCACCTGAGCCTAATACCATGTCTCCACAACACAGCTTTCAATCACCAGTGAAGGAGGAACCAGGGGAAGTAACATCTCCACCAGCATTGCAGCCATGTAGCTCACCGATGCCAGGCTCTCCTCTAGCTTCAGGCAGTTCTGACAGTGAGGATCTTGCTAAAAGGAAGAATCACAACTATTTGGAGCGTAAAAGAAGGAATGATCTGCGGTCACGATTCTTGGCACTCAGAGAAGAAGTACCAACTCTAGCCCGCTCAACAAAGACCCCCAAAGTTGTGGTGCTCAGCAAAGCAACAGAATATCTGAAGGGTCTTGTTGTTCAAGACCAGCAACTCACTGCAGAGAAGTTAAAGCTCTGGTCTCGACACCAGCAGCTCCTAAGAAGAATATCCCAACTGAAAGGTCGCTGA
Full Trace Sequence: gcgaaagagaagcagggagatagggaacaatggattttggctcctgtaataatcattatttctatgatgtggatatgaaggaggacttttatcgctgcattgctccaagtgaagacatatggaagaagtttgagcttgtgcctggctttcctctatcacctgggggatgcccaggtggtggtggaacagactggggagcagaactaatggatttagggtgggagtctcctatgaagttaactgggttaagttctgtagtcctcctgagagactgcatgtggagtggcttctctacccgagagagactagaaaaggtaatccatgagcggctgtctactgggtctcctcgagcaacaaatgcccaaaaacctgtagcagataatgaaaactcagaacctggagtagactctatagaacagaatgccacgcctttggttgtgccgacacccattccagaaaaagtacccaattcttctggatctgagagcaccagtgattcagaagaggatgagattgatgtggtaaccgttgagaagagaaagtcctatggtgggcgacaaccagtgactatcactgtacgagctgatccaacagcaactaaactctttcatatatccatacaccagcaacaacacaactatgcagcccgccttccacctgagcctaataccatgtctccacaacacagctttcaatcaccagtgaaggaggaaccaggggaagtaacatctccaccagcattgcagccatgtagctcaccgatgccaggctctcctctagcttcaggcagttctgacagtgaggatcttgctaaaaggaagaatcacaactatttggagcgtaaaagaaggaatgatctgcggtcacgattcttggcactcagagaagaagtaccaactctagcccgctcaacaaagacccccaaagttgtggtgctcagcaaagcaacagaatatctgaagggtcttgttgttcaagaccagcaactcactgcagagaagttaaagctctggtctcgacaccagcagctcctaagaagaatatcccaactgaaaggtcgctgaatggaaactgactatgcctggcacatttgcacattatatttttctagtgggagaaggagaatgtttttgggtgcacaaaagactaccacatcagactgtttgctctttggagcacattggtataaagggcttgtcctattttcaggtgactgatttctctggtttaatagcttgtctgttccctccactggccaaaatctgtttacatttttaattcctcataggtactttgacttggaagctttgtttatatttgcaaacaatggcttactctttgaaattatggcaatgtcgtgctgtacattgaggatgataaagtatggtaaggtgaaaccagttgccattgcagaatatgcttacgttgcaaattccctttagtctgcagttcaaattatatgtaactgctgtaatgcacttgcctggtactgtcatgagaaattccgacttcagactcaaaaccccctcctttcctcaaatgtatgagggcgatcatgtaaaaccacaaggcattgcaggacaaaatggctgaaggttttagctcaaatgtactataaaaccaaaaatcctgaaccttttgaatactgattactctgacctgcagcccagtataccagttttgggcactgaatgttgctttgcttggtaagagctctgttgccagtggagggaacatcatggacgtgttgtaaaccattctatacctcactcttgtcactttacattctagtttgtttgtgttgttttcaaacctgctgctgcctgtggattttttttgtactgaatggaaatttatactgtatttttgtacatctttgggaggaattgtgatttataaaaaaaaaaaaaaa
Translation: MDFGSCNNHYFYDVDMKEDFYRCIAPSEDIWKKFELVPGFPLSPGGCPGGGGTDWGAELMDLGWESPMKLTGLSSVVLLRDCMWSGFSTRERLEKVIHERLSTGSPRATNAQKPVADNENSEPGVDSIEQNATPLVVPTPIPEKVPNSSGSESTSDSEEDEIDVVTVEKRKSYGGRQPVTITVRADPTATKLFHISIHQQQHNYAARLPPEPNTMSPQHSFQSPVKEEPGEVTSPPALQPCSSPMPGSPLASGSSDSEDLAKRKNHNYLERKRRNDLRSRFLALREEVPTLARSTKTPKVVVLSKATEYLKGLVVQDQQLTAEKLKLWSRHQQLLRRISQLKGR
Donor tissue: neurula