ORFeome > LOC496438 – XORFeome 2.0

LOC496438 – XORFeome 2.0

General Information

Species: Xenopus tropicalis hypothetical LOC496438, mRNA (cDNA clone MGC:89863 IMAGE:7029045), complete cds
Gene Symbol: LOC496438
Gene ID: 496438
ORF gb_acc: MG133119
ORF ID: 10557

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC082959

Library Location

Plate ID: GDExt11006
Well Location: G04

EST Sequences

Clone: MGC:89863 IMAGE:7029045
Trimmed Sequence: ATGTCGCTACAGAAGTGCCAGGAAGAATGGGGAGAGCTGGAGAAAGAATTCCAGCAGCTACAGGAAACACACAAGGTATACAAACAGAAGCTGGAAGAATTGAATGGCCTTCAGAATCTATGCAGCAGTTATATTAATAAGCATAAGAGGCGTCTGACTGAGTTAAAAGGCAACCTTCATGGATATAAACATACCTCTAATGTTGAAGAAAAGGAACTCGTCCAGCAAATAAACAGCACAATTAAAGAGAGGCACAATGCATTTTTCGACATGGAAGCCTATTTGCCAAAGAAAAATGGTTTGTATTTAAACCTGGTGCTTGGAAATGTGAATGTCACTCTCCTTAGTAATCAAGCAAAATTTGCTTACAAGGATGAATATGAAAAATTCAAGCTTTACTTGACTATTATATTGTTACTGGGAGCTATCACATGTAGATTTGTGCTTCATTACAGGGTGACGGATGAAGTATTTAATTTCTTATTAGTCTGGTACTACTGCACTCTGACCATTAGGGAAAGTATCCTCATCAGCAATGGTTCAAGGATAAAGGGATGGTGGGTATCCCATCATTATGTCTCCACGTTTCTTTCGGGAGTGATGTTAACATGGCCAGATGGACTCATGTATCAAATATTTCGAAATCAGTTTCTGGCATTTTCCATATATCAAAGTTGTGTACAGTTTCTTCAATATTATTATCAGAGCGGCTGTTTATATCGATTACGTGCTTTAGGAGAGAGAAATCATTTAGACCTCACTGTTGAGGGGTTTCAATCATGGATGTGGCGAGGCCTTACATTTCTACTTCCTTTCCTTTTTTTTGGACATTTTTGGCAGCTGTACAATGCAATTACACTCTTTGGGCTGTCAAGACATGAAGAATGCAAAGAATGGCAGGTGTTTGTGTTGGCTCTCACATTTCTCCTGCTCTTCCTGGGGAACTTCCTGACAACTCTAAAAGTTGTTCACACAAAATTTCAGAAGAACAAGCTAAAGAAGCCTTGA
Full Trace Sequence: gctgggtcatggagttagggaggtgacgtaaggtgcgagcgtggctcctgcggccgggctcacagcggcttctaacatgtcgctacagaagtgccaggaagaatggggagagctggagaaagaattccagcagctacaggaaacacacaaggtatacaaacagaagctggaagaattgaatggccttcagaatctatgcagcagttatattaataagcataagaggcgtctgactgagttaaaaggcaaccttcatggatataaacatacctctaatgttgaagaaaaggaactcgtccagcaaataaacagcacaattaaagagaggcacaatgcatttttcgacatggaagcctatttgccaaagaaaaatggtttgtatttaaacctggtgcttggaaatgtgaatgtcactctccttagtaatcaagcaaaatttgcttacaaggatgaatatgaaaaattcaagctttacttgactattatattgttactgggagctatcacatgtagatttgtgcttcattacagggtgacggatgaagtatttaatttcttattagtctggtactactgcactctgaccattagggaaagtatcctcatcagcaatggttcaaggataaagggatggtgggtatcccatcattatgtctccacgtttctttcgggagtgatgttaacatggccagatggactcatgtatcaaatatttcgaaatcagtttctggcattttccatatatcaaagttgtgtacagtttcttcaatattattatcagagcggctgtttatatcgattacgtgctttaggagagagaaatcatttagacctcactgttgaggggtttcaatcatggatgtggcgaggccttacatttctacttcctttccttttttttggacatttttggcagctgtacaatgcaattacactctttgggctgtcaagacatgaagaatgcaaagaatggcaggtgtttgtgttggctctcacatttctcctgctcttcctggggaacttcctgacaactctaaaagttgttcacacaaaatttcagaagaacaagctaaagaagccttgagcctggtgtaagactggggcaaaaatatactggatggaatatttgcccctcccccattgtggactttagcatgagggtgggctggaaagtgcaggggctgtgctttgggtccctgatcaggctattacagtgggggttggtataatggattggaaggtgggtgcatagatgccggccagtttccctctgggagagactttcgtacttgccatttctaagctgcttttttcccccctctggaaaggatacgctcaggcctgcggtacagaccactgtgttctacggctgctaatggaattactgactctactactaatccccattaatcattttggccacattgcattttgaatcacatatgcaaaggtgggtttcccaaaccagtgtgttatggttggtaccatgtttatatggaagtacagtaagggcacaggctggagggaatgaaaaataaatgtttactactgcgaaaaaaaaaaaaaaaa
Translation: MSLQKCQEEWGELEKEFQQLQETHKVYKQKLEELNGLQNLCSSYINKHKRRLTELKGNLHGYKHTSNVEEKELVQQINSTIKERHNAFFDMEAYLPKKNGLYLNLVLGNVNVTLLSNQAKFAYKDEYEKFKLYLTIILLLGAITCRFVLHYRVTDEVFNFLLVWYYCTLTIRESILISNGSRIKGWWVSHHYVSTFLSGVMLTWPDGLMYQIFRNQFLAFSIYQSCVQFLQYYYQSGCLYRLRALGERNHLDLTVEGFQSWMWRGLTFLLPFLFFGHFWQLYNAITLFGLSRHEECKEWQVFVLALTFLLLFLGNFLTTLKVVHTKFQKNKLKKP
Donor tissue: