ORFeome > LOC496500 – XORFeome 2.0

LOC496500 – XORFeome 2.0

General Information

Species: Xenopus tropicalis hypothetical LOC496500, mRNA (cDNA clone MGC:89385 IMAGE:6989070), complete cds
Gene Symbol: LOC496500
Gene ID: 496500
ORF gb_acc: MG134355
ORF ID: 12042

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC084479

Library Location

Plate ID: GDExt11020
Well Location: C02

EST Sequences

Clone: MGC:89385 IMAGE:6989070
Trimmed Sequence: ATGGGGGGAGCGGTGAGCGCCGGGCAGGACAACGATGAGTTAATCGACAACCTGAAGGAGGCTCAGTACATTCGCTCGGAGGCGGTGGAAAGGGCTTTCCGGGCCATCGACCGCTCCGAGTATTACCTGGAGGAGTTCAAGCAGAACGCGTACCGGGACTTGGCCTGGAAACACGGCAACATCCACCTGTCGGCCCCCTGTATCTACTCCGAGGTGATGGAGGCCCTCGACCTGCAGCCGGGACTGTCCTTCCTAAACCTGGGCAGCGGCACGGGCTACCTGAGCACCATGGCCGGACTCATCCTCGGACCCTTTGGCACCAATCACGGAGTAGAAATCCACGCCGACGTAATCGAATACGCTAAGGAGAAGCTGGACCAGTTTGTGCGCACCAGCGACAGCTTCGACAGATTTGATTTCTGTGAACCTTCCTTTGTTGCCGGGAACTGCCTGGACATCGCTCTGGACGCTACGTACGACCGCGTGTACTGCGGCGCCGGGGTGCAGAAGGAGCACAAGGAGTATATGAAGAACCTGATCAAGGTGGGCGGGATCCTCGTGCTGCCATTGGAGGAAAAGCTGACCAAGATCACTCGCACGGGGCCCTCCTCCTGGGAAACCAAAAAGATCCTGGCCGTGTCCTTCGCTCCCCTCATCCAACCGGAAACGGCCGACGCCTCCAAGGCCAAGAACCTGCGGCTGCCGCTGCCCAATATCCGCTCCCTGCAGGATCTCGCCCGCATCACTATCAGGGGGCACATTAAACGGCTGATAAGCCAAGTGCCCAGCGGCCGGGGGGAGGGGGTGCTGAGGAACCCCCCGCGCTACAAGAGGAAGCGGCTGCGCCGGCGCCCCCTACAGACGGTGGTTTACCTGGAGGAGGGGGGCTTCGCGTGCCGGATACAGAATTCCTTCGATGACAATAACAACTGTGAGGACGGCGAGGAGGACGCGGCGGAGAAGGGGGAGCAGGGGGTTAGCGAGACCAAGCCGGAACCCCCCGTTAACTTTCTGCGGGAGAAGATTCTGTGCCTCCCCCTGCCTGTGCCCCTCAAATACTACCTGCTGTATTACAGAGAGAAGTGA
Full Trace Sequence: gttttttactgctcgggggagatgtgaccgggaccagagagcgactcgctgaaacgaacctcgggccaatcagctgcagcgatggggggagcggtgagcgccgggcaggacaacgatgagttaatcgacaacctgaaggaggctcagtacattcgctcggaggcggtggaaagggctttccgggccatcgaccgctccgagtattacctggaggagttcaagcagaacgcgtaccgggacttggcctggaaacacggcaacatccacctgtcggccccctgtatctactccgaggtgatggaggccctcgacctgcagccgggactgtccttcctaaacctgggcagcggcacgggctacctgagcaccatggccggactcatcctcggaccctttggcaccaatcacggagtagaaatccacgccgacgtaatcgaatacgctaaggagaagctggaccagtttgtgcgcaccagcgacagcttcgacagatttgatttctgtgaaccttcctttgttgccgggaactgcctggacatcgctctggacgctacgtacgaccgcgtgtactgcggcgccggggtgcagaaggagcacaaggagtatatgaagaacctgatcaaggtgggcgggatcctcgtgctgccattggaggaaaagctgaccaagatcactcgcacggggccctcctcctgggaaaccaaaaagatcctggccgtgtccttcgctcccctcatccaaccggaaacggccgacgcctccaaggccaagaacctgcggctgccgctgcccaatatccgctccctgcaggatctcgcccgcatcactatcagggggcacattaaacggctgataagccaagtgcccagcggccggggggagggggtgctgaggaaccccccgcgctacaagaggaagcggctgcgccggcgccccctacagacggtggtttacctggaggaggggggcttcgcgtgccggatacagaattccttcgatgacaataacaactgtgaggacggcgaggaggacgcggcggagaagggggagcagggggttagcgagaccaagccggaaccccccgttaactttctgcgggagaagattctgtgcctccccctgcctgtgcccctcaaatactacctgctgtattacagagagaagtgagggctgtgggcagtctggggggcaattagagcagcacattggcagtgcccactgccccggggcattaacgctgcttctggcttttccttattcctcctcttgctgaaccctgctgcttgcactcacaactctgggcgtcacgtgacttgcagaggatggaatatcggggattttgattgggacactggatccaactgggttttcccagccgacccaatgatgtgcctgtattggactgtattggagactgtcccgctgctttgcccgaccccaggggtgtcgtcggtagaccctgcatgtaaactccaggctggtccggtccggttgggaggttggtatcctggggaaactgggcccagcagccaacagtgatggttctgtctcagcatttccctttgtttcactcatttacagtaactttaccctctggttctggttctggtttggagtttgtgcgtgattctttggtgaagggaaataaactgacattttgggcccctccttccaaaatccggcacttagtcctgtaattctgggttccgcccactcctggggttccggtgtgagggctcagtggtctagaatgtttgggggacccccctgctattctgtgttgtgccttatttatggtttgtaggggggggggcagtccggattgttcttcaaaacaggcatttcaggggcccaaacaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MGGAVSAGQDNDELIDNLKEAQYIRSEAVERAFRAIDRSEYYLEEFKQNAYRDLAWKHGNIHLSAPCIYSEVMEALDLQPGLSFLNLGSGTGYLSTMAGLILGPFGTNHGVEIHADVIEYAKEKLDQFVRTSDSFDRFDFCEPSFVAGNCLDIALDATYDRVYCGAGVQKEHKEYMKNLIKVGGILVLPLEEKLTKITRTGPSSWETKKILAVSFAPLIQPETADASKAKNLRLPLPNIRSLQDLARITIRGHIKRLISQVPSGRGEGVLRNPPRYKRKRLRRRPLQTVVYLEEGGFACRIQNSFDDNNNCEDGEEDAAEKGEQGVSETKPEPPVNFLREKILCLPLPVPLKYYLLYYREK
Donor tissue: gastrula