ORFeome > loh11cr2a – XORFeome 2.0

loh11cr2a – XORFeome 2.0

General Information

Species: Xenopus tropicalis loh11cr2a protein, mRNA (cDNA clone MGC:79640 IMAGE:6980086), complete cds
Gene Symbol: loh11cr2a
Gene ID: 493424
ORF gb_acc: MG133589
ORF ID: 11126

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC080948

Library Location

Plate ID: GDExt11011
Well Location: A05

EST Sequences

Clone: MGC:79640 IMAGE:6980086
Trimmed Sequence: ATGGATTCCTGCTGTGGCCTTATCATCTCCTGCTCCAAGGTCCCCGTGCCGCTCCGTGGGATCTCGGTGGAGGTGCAGGTAAAAGGCTTCGTGGCTGATGTATGTGCCACACTGAGGTACAAGAACACGGAGGAGAAGCCCATAGAAGCCATCTTTGTGTTCCCTCTGGATCAGGACTCTGCCGTGTACAGCTTTGAGGCCACGGTGGAAGGGAAGACGATAGTGGCAGAGCTACAGGAGAGGGAGCAGGCCCACAAAACCTATGATGAGGCCATTAGCCAAGGCCAGGAAGCTTTTCTGCTGGAGGAGGATAAGAGCTCTGGTGACATTTTCAGCTGCAGCGTTGGGAACCTTCCCCCTGGGCAGGAGGCTGAGGTGAAACTGAGCTTCGTGCGGGAGCTGCCAGTGGAGTCAGATGGTGCTGTGCGCTTTGTGCTTCCAACTGTCCTGAACCCCAGATACACCCCAAAAGATCACGACATGAGCGTAACGGCTGCCATCCCACGATTGCCCGCTGATAAGATCCCCTACAGCCTTGCTCTGAACGCTCACTTCCAGTCCGTCTATGGAATCTCCAAGATTGAGTCCAACTGTCAGCTCGAGCCGATCCAGTACACTGATGGGGACAAACTGTCGGCCAAGGTGTCCCTGGCGCAAGGGCACAAGTTTGATAAAGATGTGGAGCTGTTGGCCTATTACCTGCAAGCAAACACCCCCAGCGCCATGGTGGAGGCGGGGCTTCCTGATGCTGTGGAAGGTTCTATCATGGCCGACCCAGTGGTGATGCTGAACTTCTACCCCAACATTCCAGAGACAAAGGAGAAGGCGAACTCCGGGGAGTTTATTTTCCTGATGGACAGGTCTGGGAGTATGATGGACAACATGAGTTCCGAGCAGAACGCCCCGCGCCGTATCGACAGCGCCAAGGAGACCCTGATCTTACTGCTCAAGAGCCTCCCCCTCGGCTGTTACTTCAATATCTTCAGCTTTGGCTCCGAATTCTCTTCCATTTTCTCGGAGAGTACGGCCTACACCCAGGAGTCCATGGCGGAAGCTGTGAAGCTGGTGAATCAGATGGATGCCGATATGGGAGGAACCGAAATCCTAGAACCATTGAAAAGGATCTACAAAACGGCTGGAAGGCCCGCTCACCCCAGACAGTTGTTTGTTTTCACCGATGGAGAAGTCGGGAACACAAAGTTCGTTATAGATGAAGTAAGAAGGAACGCCCATAATCACCGGTGTTTTACATTTGGTATTGGGGACGGGGCCTCCACGGCCCTCATTAAGGGCTTGGCCAGGGCGGCCAGTGGCACCTTTGAGTTTATCACTGGGAAGGAGAGGATGCAGCCCAAGGTTCTTCAGACCCTGAAATGTTCCCTGCAGCCCATGGTGAAGGACATCACCCTGACATGGATTCTGCCTCCTGGGGTGGAGGCCAAACTGCTGTCTGGGACTCCCACTGCCATATTCCAAGGCCAGAAATCCATTGTGTATGCCCAGCTAAAGGGCAAGGTGGAGCAGGGAACAGAAGGGCAAGTCAGCCTGGCATACAGCTTTAAAGATGAAATGGTCGCCAACGTACTGCGCTTCACCCTGAAGCTCACACAATCGGAGAGGCCCACCATGCACAGACTAGCGGCCAAGGTGGTCATCTCTAACCTGATTGGTGGGGAAAACCTAGAGGAGAAATCGGAGGAAGTGCAGAAACAGATTGTGGAGACCAGTGTCCAATCCGGGGTCATCTCCCCCCTCACGGCCTATGTAGCTGTCAATAAGGAAACCAAGAACCCAGTGAAAGGCCCCCCGGTCCAGAGGTCCATCCCACTCTATGGTGCACCAGTGGCAATGGCTTGCTGTATGCCAATGCCAAGAATGATGCCAGGTGGGCCACCAAGAGCGCTTGCTTGCAGTATGGCGGCACCAGGGTTGTCTGAACCAGAAATAGCGGTTTGTTATTGGTCAGACTCCGCTACTGTGAGCGACGGCGCCACATCTGCTCCCGCCGAGGGGTCGCCTGAACCAAAAGTAGAAGTTTGTTATTGGCCAGACCCCGCTTCTGTGAGTGACGGCGCCACATCTGCTCCCGCCGAGGGGTCGCCTGAACCAAAAGTAGAAGTTTGTTATTGGCCAGACCCCGCTTCTGTGAGCGACGGCGCCACATCTGCTCCCGCCGAGGCCAAAGCAGAACGGGCTCTGTTCCAGCTCATCTCCCTGCAGAACGCAGACGGGTCCTGGAACCTCAACTCGGAATTGGCTTCCGTCTTTGAAATGTCCGAAGAGGCTCTGAAAGAGAAAATCCCGGATCCGAGCGTGGATGCCTCACTGTGGGCCACTGTTCTGGCCGTGATGTGGCTGCACGCCGCCCGCCCCCAGCAGAGAGACGAGTGGGAGTTGCTGGAGGACAAAGCTCTGGATTGGATTAAGGCAAAAGCAGCCCCTTCCTTGAGTGAGTGCGTCCGGGCCGGAAATCAGCTGCTGAACTGCTCCGTGGGCAGCGAAGTGTTTGGCCTGTGA
Full Trace Sequence: gttcattagtgcagtagttcggcgggtcggtacttgggctcggtgccagctgatccccggggccctgacccgtctccttatctggcgaatccggggcgatatcgggctcacatcgctcctatccctgtgcgacccgccgcggccccccggctatttactggcactgacgctgcttctgatccgggaccttccggcaagtgccgcgcccagttgcagcctcagtgcgacagcgtcgggatccggcagcgctaagtaattgagacaacatggattcctgctgtggccttatcatctcctgctccaaggtccccgtgccgctccgtgggatctcggtggaggtgcaggtaaaaggcttcgtggctgatgtatgtgccacactgaggtacaagaacacggaggagaagcccatagaagccatctttgtgttccctctggatcaggactctgccgtgtacagctttgaggccacggtggaagggaagacgatagtggcagagctacaggagagggagcaggcccacaaaacctatgatgaggccattagccaaggccaggaagcttttctgctggaggaggataagagctctggtgacattttcagctgcagcgttgggaaccttccccctgggcaggaggctgaggtgaaactgagcttcgtgcgggagctgccagtggagtcagatggtgctgtgcgctttgtgcttccaactgtcctgaaccccagatacaccccaaaagatcacgacatgagcgtaacggctgccatcccacgattgcccgctgataagatcccctacagccttgctctgaacgctcacttccagtccgtctatggaatctccaagattgagtccaactgtcagctcgagccgatccagtacactgatggggacaaactgtcggccaaggtgtccctggcgcaagggcacaagtttgataaagatgtggagctgttggcctattacctgcaagcaaacacccccagcgccatggtggaggcggggcttcctgatgctgtggaaggttctatcatggccgacccagtggtgatgctgaacttctaccccaacattccagagacaaaggagaaggcgaactccggggagtttattttcctgatggacaggtctgggagtatgatggacaacatgagttccgagcagaacgccccgcgccgtatcgacagcgccaaggagaccctgatcttactgctcaagagcctccccctcggctgttacttcaatatcttcagctttggctccgaattctcttccattttctcggagagtacggcctacacccaggagtccatggcggaagctgtgaagctggtgaatcagatggatgccgatatgggaggaaccgaaatcctagaaccattgaaaaggatctacaaaacggctggaaggcccgctcaccccagacagttgtttgttttcaccgatggagaagtcgggaacacaaagttcgttatagatgaagtaagaaggaacgcccataatcaccggtgttttacatttggtattggggacggggcctccacggccctcattaagggcttggccagggcggccagtggcacctttgagtttatcactgggaaggagaggatgcagcccaaggttcttcagaccctgaaatgttccctgcagcccatggtgaaggacatcaccctgacatggattctgcctcctggggtggaggccaaactgctgtctgggactcccactgccatattccaaggccagaaatccattgtgtatgcccagctaaagggcaaggtggagcagggaacagaagggcaagtcagcctggcatacagctttaaagatgaaatggtcgccaacgtactgcgcttcaccctgaagctcacacaatcggagaggcccaccatgcacagactagcggccaaggtggtcatctctaacctgattggtggggaaaacctagaggagaaatcggaggaagtgcagaaacagattgtggagaccagtgtccaatccggggtcatctcccccctcacggcctatgtagctgtcaataaggaaaccaagaacccagtgaaaggccccccggtccagaggtccatcccactctatggtgcaccagtggcaatggcttgctgtatgccaatgccaagaatgatgccaggtgggccaccaagagcgcttgcttgcagtatggcggcaccagggttgtctgaaccagaaatagcggtttgttattggtcagactccgctactgtgagcgacggcgccacatctgctcccgccgaggggtcgcctgaaccaaaagtagaagtttgttattggccagaccccgcttctgtgagtgacggcgccacatctgctcccgccgaggggtcgcctgaaccaaaagtagaagtttgttattggccagaccccgcttctgtgagcgacggcgccacatctgctcccgccgaggccaaagcagaacgggctctgttccagctcatctccctgcagaacgcagacgggtcctggaacctcaactcggaattggcttccgtctttgaaatgtccgaagaggctctgaaagagaaaatcccggatccgagcgtggatgcctcactgtgggccactgttctggccgtgatgtggctgcacgccgcccgcccccagcagagagacgagtgggagttgctggaggacaaagctctggattggattaaggcaaaagcagccccttccttgagtgagtgcgtccgggccggaaatcagctgctgaactgctccgtgggcagcgaagtgtttggcctgtgagaagaagaggccaatggaaaccggaatctaaactgggaaatacgtctctgtgtcattggtacagttaaaggggaagctcatctgaacattaaaaaaaaaatgtaggtggtagaacgttacataaggtttagtttgtctgctctgtactgagaattaatagggtgaacttgacctttttatagctgcttattatctgctgcactatagtggggggaactggagacaatattaataactactactggttttagtggggggttctggtaccctgggcccctacctcttccttctgaacacccccaaacctgagaaacggggttactaacagccgcaccaaagatttttcattttcactaaaataaaaggaaagaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MDSCCGLIISCSKVPVPLRGISVEVQVKGFVADVCATLRYKNTEEKPIEAIFVFPLDQDSAVYSFEATVEGKTIVAELQEREQAHKTYDEAISQGQEAFLLEEDKSSGDIFSCSVGNLPPGQEAEVKLSFVRELPVESDGAVRFVLPTVLNPRYTPKDHDMSVTAAIPRLPADKIPYSLALNAHFQSVYGISKIESNCQLEPIQYTDGDKLSAKVSLAQGHKFDKDVELLAYYLQANTPSAMVEAGLPDAVEGSIMADPVVMLNFYPNIPETKEKANSGEFIFLMDRSGSMMDNMSSEQNAPRRIDSAKETLILLLKSLPLGCYFNIFSFGSEFSSIFSESTAYTQESMAEAVKLVNQMDADMGGTEILEPLKRIYKTAGRPAHPRQLFVFTDGEVGNTKFVIDEVRRNAHNHRCFTFGIGDGASTALIKGLARAASGTFEFITGKERMQPKVLQTLKCSLQPMVKDITLTWILPPGVEAKLLSGTPTAIFQGQKSIVYAQLKGKVEQGTEGQVSLAYSFKDEMVANVLRFTLKLTQSERPTMHRLAAKVVISNLIGGENLEEKSEEVQKQIVETSVQSGVISPLTAYVAVNKETKNPVKGPPVQRSIPLYGAPVAMACCMPMPRMMPGGPPRALACSMAAPGLSEPEIAVCYWSDSATVSDGATSAPAEGSPEPKVEVCYWPDPASVSDGATSAPAEGSPEPKVEVCYWPDPASVSDGATSAPAEAKAERALFQLISLQNADGSWNLNSELASVFEMSEEALKEKIPDPSVDASLWATVLAVMWLHAARPQQRDEWELLEDKALDWIKAKAAPSLSECVRAGNQLLNCSVGSEVFGL
Donor tissue: tailbud