ORFeome > lsm14a – XORFeome 2.0

lsm14a – XORFeome 2.0

General Information

Species: Xenopus tropicalis LSM14A, SCD6 homolog A, mRNA (cDNA clone MGC:69193 IMAGE:5307287), complete cds
Gene Symbol: lsm14a
Gene ID: 407942
ORF gb_acc: MG133228
ORF ID: 10699

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC067936

Library Location

Plate ID: GDExt11007
Well Location: C01

EST Sequences

Clone: MGC:69193 IMAGE:5307287
Trimmed Sequence: ATGAGTGGGGGTACTCCATACATCGGTAGCAAGATCAGCCTGATCTCCAAGGCTGAAATCCGCTATGAAGGCATTTTGTATACAATCGATACCGAAAACTCTACAGTAGCTCTCGCCAAAGTTCGATCATTTGGGACAGAGGACCGGCCAACTGACCGACCTATACCTCCCCGGGATGAAGTATTTGAATATATTATTTTCAGAGGAAGTGATATTAAAGACCTTACAGTCTGTGAGCCACCCAAACCTCAGTGTTCCTTGCCTCAGGATCCTGCTATTGTCCAGTCTTCATTAGGGTCCTCCTCTGCTTCCTCGTTCCAGTCTGTGAGCTCTTATGGACCGTTTGGCAGAATGCCTACATATAGTCAGTTCAGCACAAGTCCTCTGGTGGGGCAGCAGTTTGGTGCCGTTGGTAGCTCTCTGACATCTTTTGGAGCAGAAACAACAAGCAGCACATCTCTGCCACCGAGTAGCACTGTTGGGTCTTCTTTCACACAGGAGGCAAGGACTTTAAAAACACAGTTATCCCAAGGCCGATCAACTTCCCCATTAGATTCCTTAAGAAAGAGCCCAACCATTGAACAAGCTGTGCAGACTGCATCAGCCTCTCACGCCCCATCTGCAGCTCCTGTAGGCAGAAGAAGCCCAGTACTTTCCAGACCCCTGCCGTCCTCAAGTCAAAAGACAGGCGAGAGTTCCGAACAAAGGAAAGGTGAACTACACAAAACGCAGAGACCAGACACCGAGCAGCTCAGAAATGATAACAGACATGACCCGAACAAAAGACAGCCAGCTTCAAGTGCTCCTCAGCCTAGAAGAGGTAGAGGTGGAAATCGAGGTGGTCGTGGTAGATTTGGTGTCAGAAGAGATGGACCTATGAAATTTGAAAAAGACTTTGACTTTGAAAGTGCTAATGCTCAGTTCAACAAAGAGGAAATTGACAGAGAATTTCATAACAAACTGAAATTAAAAGATGATAAACCTGAGAAGCCAGTAAATGGAGAAGATAAGACTGATTCTGGAGTTGATACACAGAACAGTGAAGGCAATGCAGAGGAGGATGATGTCTTGGCTGGTGGAGTTTGCTACTATGATAAAACCAAATCTTTCTTTGATAATATCTCCTGTGATGACAATAGAGACAGAAGACAGACATGGTCAGAAGAAAGAAGAATTAACGCTGAAACATTCGGCCTTCCTCTCCGTTCAAACAGAGGCCGTGGTGGTTTCAGAGGCAGAGGTGGTGGTATGGGCTTCCGTGGAGGGAGAGGCCGTGGTGAGAGGAGAGGCCCACCAGGAGGTGGTGGCTTTGGATCTTCTCGGGGTTACCGCGGTGGTTCCAGAGGAGGCCGAGGTGGTAGAGAATTTGCAGAATATGAGTACAGGAAAGACAACAAAGTGGCAGCCTAG
Full Trace Sequence: gcggcagcggccatgttggtttaggttctgaaccagtgaacgtagacgggaattattggggaaggagaacccggggttcccgcaatctgcatccatccgggagacaccatgagtgggggtactccatacatcggtagcaagatcagcctgatctccaaggctgaaatccgctatgaaggcattttgtatacaatcgataccgaaaactctacagtagctctcgccaaagttcgatcatttgggacagaggaccggccaactgaccgacctatacctccccgggatgaagtatttgaatatattattttcagaggaagtgatattaaagaccttacagtctgtgagccacccaaacctcagtgttccttgcctcaggatcctgctattgtccagtcttcattagggtcctcctctgcttcctcgttccagtctgtgagctcttatggaccgtttggcagaatgcctacatatagtcagttcagcacaagtcctctggtggggcagcagtttggtgccgttggtagctctctgacatcttttggagcagaaacaacaagcagcacatctctgccaccgagtagcactgttgggtcttctttcacacaggaggcaaggactttaaaaacacagttatcccaaggccgatcaacttccccattagattccttaagaaagagcccaaccattgaacaagctgtgcagactgcatcagcctctcacgccccatctgcagctcctgtaggcagaagaagcccagtactttccagacccctgccgtcctcaagtcaaaagacaggcgagagttccgaacaaaggaaaggtgaactacacaaaacgcagagaccagacaccgagcagctcagaaatgataacagacatgacccgaacaaaagacagccagcttcaagtgctcctcagcctagaagaggtagaggtggaaatcgaggtggtcgtggtagatttggtgtcagaagagatggacctatgaaatttgaaaaagactttgactttgaaagtgctaatgctcagttcaacaaagaggaaattgacagagaatttcataacaaactgaaattaaaagatgataaacctgagaagccagtaaatggagaagataagactgattctggagttgatacacagaacagtgaaggcaatgcagaggaggatgatgtcttggctggtggagtttgctactatgataaaaccaaatctttctttgataatatctcctgtgatgacaatagagacagaagacagacatggtcagaagaaagaagaattaacgctgaaacattcggccttcctctccgttcaaacagaggccgtggtggtttcagaggcagaggtggtggtatgggcttccgtggagggagaggccgtggtgagaggagaggcccaccaggaggtggtggctttggatcttctcggggttaccgcggtggttccagaggaggccgaggtggtagagaatttgcagaatatgagtacaggaaagacaacaaagtggcagcctagtgaaggatgaaagagcgtcaaagtggattttataatcatttgcggtccatagaacttgttttcagtcttttgtgaagaatgaaatttatcttgctgtacattttgtcaccagcactgggggatttactctgaggactccttaagtgtttcagggtccttctgttcattgggtacttctgcacaatggatccctgtaacactaaaggatgcagaatgggcgttgctcaatttattctgtatctattttttttttctttttcatttttgaaaaaaagaccatctttaaaaaaaaaaaaaaaaaaaaa
Translation: MSGGTPYIGSKISLISKAEIRYEGILYTIDTENSTVALAKVRSFGTEDRPTDRPIPPRDEVFEYIIFRGSDIKDLTVCEPPKPQCSLPQDPAIVQSSLGSSSASSFQSVSSYGPFGRMPTYSQFSTSPLVGQQFGAVGSSLTSFGAETTSSTSLPPSSTVGSSFTQEARTLKTQLSQGRSTSPLDSLRKSPTIEQAVQTASASHAPSAAPVGRRSPVLSRPLPSSSQKTGESSEQRKGELHKTQRPDTEQLRNDNRHDPNKRQPASSAPQPRRGRGGNRGGRGRFGVRRDGPMKFEKDFDFESANAQFNKEEIDREFHNKLKLKDDKPEKPVNGEDKTDSGVDTQNSEGNAEEDDVLAGGVCYYDKTKSFFDNISCDDNRDRRQTWSEERRINAETFGLPLRSNRGRGGFRGRGGGMGFRGGRGRGERRGPPGGGGFGSSRGYRGGSRGGRGGREFAEYEYRKDNKVAA
Donor tissue: gastrula