ORFeome > lta4h – XORFeome 2.0

lta4h – XORFeome 2.0

General Information

Species: Xenopus tropicalis leukotriene A4 hydrolase, mRNA (cDNA clone MGC:69197 IMAGE:5307344), complete cds
Gene Symbol: lta4h
Gene ID: 448745
ORF gb_acc: MG133257
ORF ID: 10740

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC074626

Library Location

Plate ID: GDExt11007
Well Location: C06

EST Sequences

Clone: MGC:69197 IMAGE:5307344
Trimmed Sequence: ATGGCAGACCCCAGCTCCTTTGCCTCTCCGGAGAAGTTTAACATCAAGCATATGAATCTCAAATTGCATGTAGATTTTGCCTCCTGTGTTATCACAGCTTCAACTTCACTGACCGTGCGTTCTCTGCAGGACTCGCTGGCATCCCTGATTTTGGATACCAAAGACCTCACCATTAAAAAAGTTGCTGTTAATGGGAAAGATGCAAAGTTTGCACTTGGAACAAGTCACAGCTTCAAAGGAACTCCTCTGGAAATAACACTTCCTTTTTCACTTACAAGAGGACAAGACGTTATTGTGGAAATTGATTCGGTCACCTCTCCCAAATCATCCGCCCTTCAGTGGCTCACCGCAGAACAGACAGCAGGAAAGGTCCATCCTTATCTCTTCAGTCAGTGCCAGGCTACACATTGCAGAAGTATAATACCATGCCAAGATACACCATCAGTGAAATTCACCTACTGCAGCCAGGTTTCAGTCCCAAAGGAGCTGGTGGCTCTGATGAGTGCACTTCGTGATGGAGAATTAGTAGAGCAAAATGACTGCAGCAGAAAGATTTACTGCTTCATGCAAAATGTGCCGATACCCAGTTATTTAATTGCATTGGTTGTTGGAGCTTTGGAGGGCAGAAAGGGTGGTCCTAGAACAACCATTTGGACTGAGAAGGAGCTTTTGGAACCATCTGTCTATGAATTCTCTGAGACAGAGAAGATGCTCAAATATGCAGAAGACTTGGTTGGCCCCTATGTGTGGGGTCAATATGATCTGCTTATATTGCCTCCTTCATTCCCATACGGGGGCATGGAGAATCCCTGCCTCACGTTTGTTACCCCAACTGTGCTGGCTGGTGACCGCTCTTTGGCAGGTGTGATTGCACATGAAATTTCACACAGCTGGACAGGAAACCTGGTTACAAATGAAACTTGGGAAAACTTCTGGCTAAATGAAGGTCATACTGTATACCTGGAGCGCAGGATTGATGGCCTTCTTCATGGTGAAGAGTTTCGGCAATTTAAGGCTCTGGGGGGTTGGAAAGAACTGCAGAATTCGGTTAATACATTTGGAGCCACCAATCCTCTTACAAACCTGGTACCCAATCTGCATGAGGTAGATGTAGATGCTGCATTTTCCTCTGTTCCGTATGAAAAAGGATTTGCTTTGTTGTTCTATCTGGAGCAGCTCCTTGGAGGGCCAGAAATCTTCTTGGGGTTCCTGAAATCGTACATTCAGATGTTTGCCTACAAAAGTGTCACCACAGAGCAATGGAAGAATTTCCTGTATTCATATTTTAAGGACAAGGTGGATATTCTTGACAAGGTGGACTGGAAAGGATGGATGCATACCCCTGGGATGCCACCAGTACAACCCAAGTATGACATGACACTAGCTAATGCTTGTATCGCTCTCAGCCAGAAATGGGTCAAGGCTAAGGAAAGTGATCTGAGCTCATTTAACGCTGATGACGTAAAGGATTTATCATCTCACCAACTCATCGAAGTCTTGACCATCTTGCTGCTAGAGGCACCTCTGACAGTCTCTCATGTGAAACGAATGCAAGAAGTATACAACCTAAATGATGTCAAGAATTCTGAAATACGATTCAGGTGGCTACGGCTTTGTATTCGGGCTAAATGTGAAGACGTCATACCCTTAGCTCTAAAGATGACAACTGAACAAGGAAGAATGAAGTTCACACGCCCTCTGTATAGGGATCTGTACAACTTTGAGAAGGCTCGAGAAGAAACGGTTAACACCTTTCTGAAGAACAGATCATGTATGCATCCTGTGACTGAAATGCTTGTGGCAAAGGATCTCAATATCAGTGCCTCATAA
Full Trace Sequence: gtcagacgtaactgatccgtgagacagagggagcggttcggtgtgtgagcttgttcacttgttaccctgcagcagacatggcagaccccagctcctttgcctctccggagaagtttaacatcaagcatatgaatctcaaattgcatgtagattttgcctcctgtgttatcacagcttcaacttcactgaccgtgcgttctctgcaggactcgctggcatccctgattttggataccaaagacctcaccattaaaaaagttgctgttaatgggaaagatgcaaagtttgcacttggaacaagtcacagcttcaaaggaactcctctggaaataacacttcctttttcacttacaagaggacaagacgttattgtggaaattgattcggtcacctctcccaaatcatccgcccttcagtggctcaccgcagaacagacagcaggaaaggtccatccttatctcttcagtcagtgccaggctacacattgcagaagtataataccatgccaagatacaccatcagtgaaattcacctactgcagccaggtttcagtcccaaaggagctggtggctctgatgagtgcacttcgtgatggagaattagtagagcaaaatgactgcagcagaaagatttactgcttcatgcaaaatgtgccgatacccagttatttaattgcattggttgttggagctttggagggcagaaagggtggtcctagaacaaccatttggactgagaaggagcttttggaaccatctgtctatgaattctctgagacagagaagatgctcaaatatgcagaagacttggttggcccctatgtgtggggtcaatatgatctgcttatattgcctccttcattcccatacgggggcatggagaatccctgcctcacgtttgttaccccaactgtgctggctggtgaccgctctttggcaggtgtgattgcacatgaaatttcacacagctggacaggaaacctggttacaaatgaaacttgggaaaacttctggctaaatgaaggtcatactgtatacctggagcgcaggattgatggccttcttcatggtgaagagtttcggcaatttaaggctctggggggttggaaagaactgcagaattcggttaatacatttggagccaccaatcctcttacaaacctggtacccaatctgcatgaggtagatgtagatgctgcattttcctctgttccgtatgaaaaaggatttgctttgttgttctatctggagcagctccttggagggccagaaatcttcttggggttcctgaaatcgtacattcagatgtttgcctacaaaagtgtcaccacagagcaatggaagaatttcctgtattcatattttaaggacaaggtggatattcttgacaaggtggactggaaaggatggatgcatacccctgggatgccaccagtacaacccaagtatgacatgacactagctaatgcttgtatcgctctcagccagaaatgggtcaaggctaaggaaagtgatctgagctcatttaacgctgatgacgtaaaggatttatcatctcaccaactcatcgaagtcttgaccatcttgctgctagaggcacctctgacagtctctcatgtgaaacgaatgcaagaagtatacaacctaaatgatgtcaagaattctgaaatacgattcaggtggctacggctttgtattcgggctaaatgtgaagacgtcatacccttagctctaaagatgacaactgaacaaggaagaatgaagttcacacgccctctgtatagggatctgtacaactttgagaaggctcgagaagaaacggttaacacctttctgaagaacagatcatgtatgcatcctgtgactgaaatgcttgtggcaaaggatctcaatatcagtgcctcataacgcaccattactaccaaccagccttaactgattattttatgcagtcatgacttggtgtgacaacccagtacaaattactttgttaaagaagttttatacgcttgcaactttttcccagaagaataatccactttgctgaaataaaacaaatgacattataaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MADPSSFASPEKFNIKHMNLKLHVDFASCVITASTSLTVRSLQDSLASLILDTKDLTIKKVAVNGKDAKFALGTSHSFKGTPLEITLPFSLTRGQDVIVEIDSVTSPKSSALQWLTAEQTAGKVHPYLFSQCQATHCRSIIPCQDTPSVKFTYCSQVSVPKELVALMSALRDGELVEQNDCSRKIYCFMQNVPIPSYLIALVVGALEGRKGGPRTTIWTEKELLEPSVYEFSETEKMLKYAEDLVGPYVWGQYDLLILPPSFPYGGMENPCLTFVTPTVLAGDRSLAGVIAHEISHSWTGNLVTNETWENFWLNEGHTVYLERRIDGLLHGEEFRQFKALGGWKELQNSVNTFGATNPLTNLVPNLHEVDVDAAFSSVPYEKGFALLFYLEQLLGGPEIFLGFLKSYIQMFAYKSVTTEQWKNFLYSYFKDKVDILDKVDWKGWMHTPGMPPVQPKYDMTLANACIALSQKWVKAKESDLSSFNADDVKDLSSHQLIEVLTILLLEAPLTVSHVKRMQEVYNLNDVKNSEIRFRWLRLCIRAKCEDVIPLALKMTTEQGRMKFTRPLYRDLYNFEKAREETVNTFLKNRSCMHPVTEMLVAKDLNISAS
Donor tissue: gastrula