ORFeome > mad1l1 – XORFeome 2.0

mad1l1 – XORFeome 2.0

General Information

Species: Xenopus tropicalis MAD1 mitotic arrest deficient-like 1 (yeast), mRNA (cDNA clone MGC:89327 IMAGE:6987500), complete cds
Gene Symbol: mad1l1
Gene ID: 448774
ORF gb_acc: MG133912
ORF ID: 11505

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC076947

Library Location

Plate ID: GDExt11014
Well Location: E11

EST Sequences

Clone: MGC:89327 IMAGE:6987500
Trimmed Sequence: ATGGATGACAGTGAAGACAACACCACTGTCATTTCCACACTACGGTCATTTAATAAATTTCTTTCTCAGCCATTGGAAGGGACAGCACCTTCTCTTGGTACTTCAACATCTACTGGAGCTTCCCTTCAAATGCAGTTTCAGCAGCGCTTTCTGCTGGAAGACCAGGCAGCGCAGATTCGTTCAAAGTCTCATCTTATTCAGGTTGAACGTGAAAAGATGCAGATGGAACTAAGCCACAAACGGGCCCGTATTGAGCTTGAGAAAGCAGCCAGCACCAACGCCAAGAATTACGAGCGGGAAGCAGACAGGAACCAGGAGCTCATCACCCGCATCAAGGCTCTAGAGGAAAGGGAGAATGATTTTCAGAACAAACTTCAAGAGCAGAATGAAATGATCAAATCCTACAAGAAAACCATAGAGGCTCAAAGCAAGAAGCTGCTGGAGAAAGAGGACAAACTGTCTGAATTAAATGAGAACATCAGTGTGTTAAAAGGAAAAGCAACTGAGCTTCAGTGGAAGATAATGAACCAAGAAATGCAAATAAAGACCCAGGAGACTGAGAAGCAGGAGATGACAGAGCAGCTGGAAATCCATCGCAAAAAGCTGCAAGAAAGCAATGAGAAGATGCAGGCACTGCATGAGCTTCAGGCGCAAAATGTTGATAATGAACAGAAAATCAAGAGCCTGGAACAGAAACTGTCAGCCCAGGAACAGGATGCTGCCATTGTGAAGAGCATGAAATCTGATTTGGCCAAATTGCCGAAACTGGAAAGGGAATTACAGCAGCTCAGAGATGAGAATGCTTACCACAGAGAAATGAAAGAAAACAATGCATTGCTTAAAGAAGAAGTAGAGGGTCTGCGCAGAGCCGCAGAACGCTTTAATAAAATGAAAGAAGACCTGGTGGGATTGGAAATTGAGAAAGAACAACTGCTAAAGAAGCTGAAACTTTGGGAGAGCCTTGAGCATACAACTGGATTAAACATAAGAACTCCGGATGATCTTTCCAGACAAATCATTGCAGTGCAACAGAGAGAGCTGAAGCTGAAAGAGGAGAACATGACAATTCAGAACAGTGCAAGAATGCTGGAAACATCACGGCAGCAGCTGCGAGAAGAACTTTTAAAAGTCCAGGCCGGTTTTCTAGAAGAAAAGAAAAGGAGAGAGCATCAGGAGGCATTTGTACGCCGTTTGCAAAAGCGGGTCCTTCTTCTGACTAAGGAACGGGATGGAATGAGAGCCATTTTGGATTCTTATGATAGTGAGTTGACCCCGACCGAACATTCTCCTCAACTGAGCCGCCGCCTGCGGGAAGCAGAAGATATGGTACAGAAGGTTCAGGACCACAATGCTGAAATGGAGACACAGTTGTCAGAGGCGCTGGAAGAAACAGGCATTCAGAAGCAGAAGTCTGATCTTTTAATGGCAGAGCTGAAAGTCTTAAAGTCTCAGATGGGCTCATCAGATCAAAACATCTCTTTTACAAATGAGGCAATGAACACTCTCAGATTGAAAATAGAGGAGCTTGAAGCTGAACGTGGTAGATTAGAGGAAGAGAACAAAATCTTAGAGATGAGACTGGAACGCTTGAATCTTCAGGGATGCTACGACCCAAGCAAAACAAAAGTGATCCACTTGGGTCTAAATCCCTCAAGTCAAGCCAAGCAGCAACGTGCGGAAACAGTGCGCCAATTACAGGAAGAATGCAGTAAGCTGCGGGAGCTTGTAAGGATTTTAGAGGGAGGAGCCCAAATCCCAGACAAACTGGAGGCAGCTGGAAGTGTGCAGTCTTCCCAGGAACTTACAGAACTGAAGAAGCAGTTGGAGAGTGCTGAATTGAAAAACCAGCGTCTTCGGGAGGTCTTCCAGACGAAAATTCATGAGTTCCGTACCGCGTGCTACATGCTGACAGGGTATCGCATTGATATCACCACTGAGAATCAGTACCGCCTTACATCCATGTATGCGGAACAGAAAGAAGATAACTTGTTGTTCAAGGCGTCCGGCTCCTCCGGAGGGAAGATGCAGCTGCTAGAGACGGACTTCTCTTTGACCTTGCGTGATTTTATTGATCTTCACCTACATCACCAGAACAGCATCCCAGCATTCCTCAGTGCAGTCACCCTTGACCTCTTCAGTCGCCAGACCTTTGCGTAA
Full Trace Sequence: ggattgttcatttcagggaagggaaggaggaatctggcgatctgcctgtaacctgtgaacagctaaaatggatgacagtgaagacaacaccactgtcatttccacactacggtcatttaataaatttctttctcagccattggaagggacagcaccttctcttggtacttcaacatctactggagcttcccttcaaatgcagtttcagcagcgctttctgctggaagaccaggcagcgcagattcgttcaaagtctcatcttattcaggttgaacgtgaaaagatgcagatggaactaagccacaaacgggcccgtattgagcttgagaaagcagccagcaccaacgccaagaattacgagcgggaagcagacaggaaccaggagctcatcacccgcatcaaggctctagaggaaagggagaatgattttcagaacaaacttcaagagcagaatgaaatgatcaaatcctacaagaaaaccatagaggctcaaagcaagaagctgctggagaaagaggacaaactgtctgaattaaatgagaacatcagtgtgttaaaaggaaaagcaactgagcttcagtggaagataatgaaccaagaaatgcaaataaagacccaggagactgagaagcaggagatgacagagcagctggaaatccatcgcaaaaagctgcaagaaagcaatgagaagatgcaggcactgcatgagcttcaggcgcaaaatgttgataatgaacagaaaatcaagagcctggaacagaaactgtcagcccaggaacaggatgctgccattgtgaagagcatgaaatctgatttggccaaattgccgaaactggaaagggaattacagcagctcagagatgagaatgcttaccacagagaaatgaaagaaaacaatgcattgcttaaagaagaagtagagggtctgcgcagagccgcagaacgctttaataaaatgaaagaagacctggtgggattggaaattgagaaagaacaactgctaaagaagctgaaactttgggagagccttgagcatacaactggattaaacataagaactccggatgatctttccagacaaatcattgcagtgcaacagagagagctgaagctgaaagaggagaacatgacaattcagaacagtgcaagaatgctggaaacatcacggcagcagctgcgagaagaacttttaaaagtccaggccggttttctagaagaaaagaaaaggagagagcatcaggaggcatttgtacgccgtttgcaaaagcgggtccttcttctgactaaggaacgggatggaatgagagccattttggattcttatgatagtgagttgaccccgaccgaacattctcctcaactgagccgccgcctgcgggaagcagaagatatggtacagaaggttcaggaccacaatgctgaaatggagacacagttgtcagaggcgctggaagaaacaggcattcagaagcagaagtctgatcttttaatggcagagctgaaagtcttaaagtctcagatgggctcatcagatcaaaacatctcttttacaaatgaggcaatgaacactctcagattgaaaatagaggagcttgaagctgaacgtggtagattagaggaagagaacaaaatcttagagatgagactggaacgcttgaatcttcagggatgctacgacccaagcaaaacaaaagtgatccacttgggtctaaatccctcaagtcaagccaagcagcaacgtgcggaaacagtgcgccaattacaggaagaatgcagtaagctgcgggagcttgtaaggattttagagggaggagcccaaatcccagacaaactggaggcagctggaagtgtgcagtcttcccaggaacttacagaactgaagaagcagttggagagtgctgaattgaaaaaccagcgtcttcgggaggtcttccagacgaaaattcatgagttccgtaccgcgtgctacatgctgacagggtatcgcattgatatcaccactgagaatcagtaccgccttacatccatgtatgcggaacagaaagaagataacttgttgttcaaggcgtccggctcctccggagggaagatgcagctgctagagacggacttctctttgaccttgcgtgattttattgatcttcacctacatcaccagaacagcatcccagcattcctcagtgcagtcacccttgacctcttcagtcgccagacctttgcgtaaaggctgagggcaacatgtagctaaccatcctctcaaatgtacgtgttactgaaatgaaatgatttgttagttaagttgtaaaaaatggatccgactactgaatattgtttgcatttgaaatcaaatccttgatggcccaggtgtttttgtactgtgtgtctgattaactaaatatgaataaagaccaatgttgcattataatgtttccaaggatgaatcaataagtagcatcgtgacatcatgctgtgatgtaataaattcttttaataaaaaacaaaaaaataaaaaagaaaaaatcaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MDDSEDNTTVISTLRSFNKFLSQPLEGTAPSLGTSTSTGASLQMQFQQRFLLEDQAAQIRSKSHLIQVEREKMQMELSHKRARIELEKAASTNAKNYEREADRNQELITRIKALEERENDFQNKLQEQNEMIKSYKKTIEAQSKKLLEKEDKLSELNENISVLKGKATELQWKIMNQEMQIKTQETEKQEMTEQLEIHRKKLQESNEKMQALHELQAQNVDNEQKIKSLEQKLSAQEQDAAIVKSMKSDLAKLPKLERELQQLRDENAYHREMKENNALLKEEVEGLRRAAERFNKMKEDLVGLEIEKEQLLKKLKLWESLEHTTGLNIRTPDDLSRQIIAVQQRELKLKEENMTIQNSARMLETSRQQLREELLKVQAGFLEEKKRREHQEAFVRRLQKRVLLLTKERDGMRAILDSYDSELTPTEHSPQLSRRLREAEDMVQKVQDHNAEMETQLSEALEETGIQKQKSDLLMAELKVLKSQMGSSDQNISFTNEAMNTLRLKIEELEAERGRLEEENKILEMRLERLNLQGCYDPSKTKVIHLGLNPSSQAKQQRAETVRQLQEECSKLRELVRILEGGAQIPDKLEAAGSVQSSQELTELKKQLESAELKNQRLREVFQTKIHEFRTACYMLTGYRIDITTENQYRLTSMYAEQKEDNLLFKASGSSGGKMQLLETDFSLTLRDFIDLHLHHQNSIPAFLSAVTLDLFSRQTFA
Donor tissue: gastrula