ORFeome > matn2 – XORFeome 2.0

matn2 – XORFeome 2.0

General Information

Species: Xenopus tropicalis matrilin 2, mRNA (cDNA clone MGC:76198 IMAGE:5335980), complete cds
Gene Symbol: matn2
Gene ID: 394847
ORF gb_acc: MG132804
ORF ID: 10147

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC063920

Library Location

Plate ID: GDExt11002
Well Location: A04

EST Sequences

Clone: MGC:76198 IMAGE:5335980
Trimmed Sequence: ATGAGCCTCATCCATTCGTGCTGCCTTGCCCTCTTGCTGTTCCTGGGTGTGGATGCGAGAGAGAAGCGTCAGTCAGCAGCTGTCACAGCCCGAAGAAATGAAGTTGATAGCCAAGCCGCCTTCCTTAGGAGTGCGTGCCATAACAAGCCGCTGGATCTTGTGTTCATCATTGATAGCTCTCGCAGCGTACGGCCCCCTGACTTTGAGAAGGTGAAGGAATTTCTTATCACCATGTTGAAGTTTCTAGACATTGGCCCAGATACCACGAGGGTCGGACTCCTGCAGTACGGCAGCACTGTGAAAAACGAGTTTTCTCTGAAGACGTACAAGAAAAAAATGGACATTGAAAGAGCAGTGAAAAGAATGATGCATTTGGCCACCGGCACCATGACTGGACTGGCTATCCAGTATGCCATGAACATTGCCTTCTCTGAATCTGAAGGGGCACGGCCCTTAAACCAACACGTGCCAAGAATCGCCATGATTGTAACAGATGGGCGGCCACAGGATCCAGTAGCGGAAATTGCAGCGAAGGCGAGGAACTCTGGCATTCTTATCTTTGCCGTTGGGGTTGGCCGAGTCGACATGAGCACTTTAAAAACCATTGGAAGTGAGCCCCACACCGAGCACGTGTTTTTGGTGGCAAATTTTAGCCAAATCGAAACACTGACAACAGTTTTCCAGAACAAACTATGTGCTCCACATCTCTGTAGCACAGCCAGACATGGTTGTGATCACTTTTGTATCAATACGCCAGGCTCCTACCTTTGTAAATGCAAGCAAGGCTACGTTCTGAATCCCGATGAGAAGACGTGCAGCACCCAGGACCTGTGTGCCACCGAGAAACATGGCTGTGAGCAAATCTGTGTCAATACCCCAGGATCATATTTGTGCCAGTGCTATGAAGCCTATAAATTGGCTGCTGATGGAAAATCCTGTACTGTTACAGACTATTGTGCCGTGGGTAATCATGGCTGCCAACACCAATGCATCAATGTTAATGACACCTACGTCTGCCAGTGCCACCCGGGGTTTATTCTCAACCAAGATAAGAAAACCTGCAGGAGACCAGACTACTGCGCTATGTCCAACCATGGCTGTCAGCACGAGTGCGTGAATAATGATAACTCCTTTGTCTGTAAATGCCGCAATGGATTTTCTCTTAACCCCGACAAGAAAACTTGCCGAAAAATCAACCACTGTGCTTTGGGCAGGAACGGATGCCAGCACGAATGCGTGAACACTGACAACTCCTTCTTATGTAGATGCCACAAAGGTTACGCATTGAACCAGGACGGAAAAACCTGCAGAAAGGTGGACCGCTGTGCTGAGACCAACCATGGGTGCCAGCATATTTGCATGAATACAGATGACTCCTTCACCTGTCGCTGCTATGAAGGGTTCCTCCTAACTGAAGACCTAAAAACCTGCAGGGCTGTGGACCACTGTGCTTTGAGCAACCATGACTGTGAGCACTTGTGTGTAAATACTGAAGGCTCCTACACTTGCCATTGCTTTGAAGGCTATGACCTCCGTGATGATAAAAAGACATGTAGAAGTCGAGATATTTGCAAGTCCCTTGACCATGGCTGTGAGCATATCTGTGTGAGCAGTGACGATTCCTACCTCTGCAAATGCTTTGAAGGATACACCTTGGGAGAAGATGGAAAAAGCTGCAAAAGTGAAAGAAAATGCGGGGAAGGGCCAGTCGACCTGGTATTTGTCATTGATGGGTCTAAAAGCCTCGGAGAGAACAACTTTGAGATTGTAAAGCAGTTTGTCAATGGGATTTTAGATTCCCTTGAAATCTCCCAGAAAGCAGCCCATGTAGGACTGATTCAGTATTCCACTCACATCCGCACGGAGTTTACAATGGCGCAATACAGTTCAGCCAAAGACGTGAAAAAGGCCGTGTCTCAGATAAAATACATGGGCAGAGGCTCCATGACTGGACTGGCCTTGAAGTTAATGCACGAGAAAAGCTTTTCAGAAGTGCAGGGTGCAAGGCCGCGGGCCATGGGTGTCCCCAGAGTGGCGATCGTGTTCACAGATGGACGAGCTCAGGATGAAGTATCCGAGTATGCTAAAAAAGCCAAACAAAGCGGCATTACCATCTATGCTATTGGAGTAGGGAAGGCAATAGATGAAGAACTACAAGAGATTGCTTCTGCGCCCCAGGAGAAGCACGTGATCTACGCAGAAGACTTCAGTGCAATGGGGTACATAACAGAGAAGCTGAAATCCAGCATTTGTGAAGGATGGGGTAAAACTGATGTTTCCAATTCAGAACTTTCTTCTGAGCTCAAGAGCGGGAGCAGTGAAGTGACAGTGTCGTGTTCTATGTCCACCATAAAGCTGACTACCCAAGCGGAAGAGAAAGCCACAGAGGATCAGTGCAAGTGTAAGAATATCTTGGACTTTCAAAACAGCGCCACGGAAGAAGTCAAGAGGCTAACGCAACAATTAGATGCAGTAACACGGCGACTGGAACAACTGGAGAAACGCGTGGGTCAGAAATAG
Full Trace Sequence: tcttactactggtgcagctctccgtccccagcagcagacatgagcctcatccattcgtgctgccttgccctcttgctgttcctgggtgtggatgcgagagagaagcgtcagtcagcagctgtcacagcccgaagaaatgaagttgatagccaagccgccttccttaggagtgcgtgccataacaagccgctggatcttgtgttcatcattgatagctctcgcagcgtacggccccctgactttgagaaggtgaaggaatttcttatcaccatgttgaagtttctagacattggcccagataccacgagggtcggactcctgcagtacggcagcactgtgaaaaacgagttttctctgaagacgtacaagaaaaaaatggacattgaaagagcagtgaaaagaatgatgcatttggccaccggcaccatgactggactggctatccagtatgccatgaacattgccttctctgaatctgaaggggcacggcccttaaaccaacacgtgccaagaatcgccatgattgtaacagatgggcggccacaggatccagtagcggaaattgcagcgaaggcgaggaactctggcattcttatctttgccgttggggttggccgagtcgacatgagcactttaaaaaccattggaagtgagccccacaccgagcacgtgtttttggtggcaaattttagccaaatcgaaacactgacaacagttttccagaacaaactatgtgctccacatctctgtagcacagccagacatggttgtgatcacttttgtatcaatacgccaggctcctacctttgtaaatgcaagcaaggctacgttctgaatcccgatgagaagacgtgcagcacccaggacctgtgtgccaccgagaaacatggctgtgagcaaatctgtgtcaataccccaggatcatatttgtgccagtgctatgaagcctataaattggctgctgatggaaaatcctgtactgttacagactattgtgccgtgggtaatcatggctgccaacaccaatgcatcaatgttaatgacacctacgtctgccagtgccacccggggtttattctcaaccaagataagaaaacctgcaggagaccagactactgcgctatgtccaaccatggctgtcagcacgagtgcgtgaataatgataactcctttgtctgtaaatgccgcaatggattttctcttaaccccgacaagaaaacttgccgaaaaatcaaccactgtgctttgggcaggaacggatgccagcacgaatgcgtgaacactgacaactccttcttatgtagatgccacaaaggttacgcattgaaccaggacggaaaaacctgcagaaaggtggaccgctgtgctgagaccaaccatgggtgccagcatatttgcatgaatacagatgactccttcacctgtcgctgctatgaagggttcctcctaactgaagacctaaaaacctgcagggctgtggaccactgtgctttgagcaaccatgactgtgagcacttgtgtgtaaatactgaaggctcctacacttgccattgctttgaaggctatgacctccgtgatgataaaaagacatgtagaagtcgagatatttgcaagtcccttgaccatggctgtgagcatatctgtgtgagcagtgacgattcctacctctgcaaatgctttgaaggatacaccttgggagaagatggaaaaagctgcaaaagtgaaagaaaatgcggggaagggccagtcgacctggtatttgtcattgatgggtctaaaagcctcggagagaacaactttgagattgtaaagcagtttgtcaatgggattttagattcccttgaaatctcccagaaagcagcccatgtaggactgattcagtattccactcacatccgcacggagtttacaatggcgcaatacagttcagccaaagacgtgaaaaaggccgtgtctcagataaaatacatgggcagaggctccatgactggactggccttgaagttaatgcacgagaaaagcttttcagaagtgcagggtgcaaggccgcgggccatgggtgtccccagagtggcgatcgtgttcacagatggacgagctcaggatgaagtatccgagtatgctaaaaaagccaaacaaagcggcattaccatctatgctattggagtagggaaggcaatagatgaagaactacaagagattgcttctgcgccccaggagaagcacgtgatctacgcagaagacttcagtgcaatggggtacataacagagaagctgaaatccagcatttgtgaaggatggggtaaaactgatgtttccaattcagaactttcttctgagctcaagagcgggagcagtgaagtgacagtgtcgtgttctatgtccaccataaagctgactacccaagcggaagagaaagccacagaggatcagtgcaagtgtaagaatatcttggactttcaaaacagcgccacggaagaagtcaagaggctaacgcaacaattagatgcagtaacacggcgactggaacaactggagaaacgcgtgggtcagaaataggaaggtgttggttaaaccgtaagagcatctgagcagaaccaaagttacacgatggaagcagcggaacagagctgcacagttcagcacaactcccccagactggatcagagttttatagcacacagcaaatcatattctatttatgtacagatgggattgcatgtcggaatccagaaaactagaactatggaatatttggcgccgcttaatttatggaacagagaattcatttggaagagtaatgaggaagaaacagttttgtgggccaaagtctattttgtaaatccaagatattttttagcttttctctcgtggttttataaaatatgaataaattgtcaagtatttttaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MSLIHSCCLALLLFLGVDAREKRQSAAVTARRNEVDSQAAFLRSACHNKPLDLVFIIDSSRSVRPPDFEKVKEFLITMLKFLDIGPDTTRVGLLQYGSTVKNEFSLKTYKKKMDIERAVKRMMHLATGTMTGLAIQYAMNIAFSESEGARPLNQHVPRIAMIVTDGRPQDPVAEIAAKARNSGILIFAVGVGRVDMSTLKTIGSEPHTEHVFLVANFSQIETLTTVFQNKLCAPHLCSTARHGCDHFCINTPGSYLCKCKQGYVLNPDEKTCSTQDLCATEKHGCEQICVNTPGSYLCQCYEAYKLAADGKSCTVTDYCAVGNHGCQHQCINVNDTYVCQCHPGFILNQDKKTCRRPDYCAMSNHGCQHECVNNDNSFVCKCRNGFSLNPDKKTCRKINHCALGRNGCQHECVNTDNSFLCRCHKGYALNQDGKTCRKVDRCAETNHGCQHICMNTDDSFTCRCYEGFLLTEDLKTCRAVDHCALSNHDCEHLCVNTEGSYTCHCFEGYDLRDDKKTCRSRDICKSLDHGCEHICVSSDDSYLCKCFEGYTLGEDGKSCKSERKCGEGPVDLVFVIDGSKSLGENNFEIVKQFVNGILDSLEISQKAAHVGLIQYSTHIRTEFTMAQYSSAKDVKKAVSQIKYMGRGSMTGLALKLMHEKSFSEVQGARPRAMGVPRVAIVFTDGRAQDEVSEYAKKAKQSGITIYAIGVGKAIDEELQEIASAPQEKHVIYAEDFSAMGYITEKLKSSICEGWGKTDVSNSELSSELKSGSSEVTVSCSMSTIKLTTQAEEKATEDQCKCKNILDFQNSATEEVKRLTQQLDAVTRRLEQLEKRVGQK
Donor tissue: tailbud