ORFeome > mccc1 – XORFeome 2.0

mccc1 – XORFeome 2.0

General Information

Species: Xenopus tropicalis methylcrotonoyl-Coenzyme A carboxylase 1 (alpha), mRNA (cDNA clone MGC:89118 IMAGE:7006789), complete cds
Gene Symbol: mccc1
Gene ID: 448313
ORF gb_acc: MG134078
ORF ID: 11702

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC075388

Library Location

Plate ID: GDExt11017
Well Location: B01

EST Sequences

Clone: MGC:89118 IMAGE:7006789
Trimmed Sequence: ATGGCGGCCACCTTGATACTTCTGAGGGGGAGAACCTGTCCTGGCTTCTGTGTGCTTCTGCACCAGCGGAAATGGACCTGTGGCCCCAAACTAATCAGATATGCTTCAGAAACAGGAAGAAGTAAAATCGAGAAAGTCCTCATTGCAAACAGAGGGGAGATTGCCTGCAGGGTGATGCGCACTGCTAAGAAGATGGGTGTACGGTCTGTAGCAGTTTACAGTGAAGCAGACAGGAACACTATGCATGTCTCCTTGGCAGATGAAGCATATTTAATTGGTCCGGCTGCTTCACAACAGAGTTACCTTGCTATGGATAAAATATTGCAAGTAGCAAAGAGGTCAGGAGCACAGGCTATTCACCCTGGTTATGGTTTCCTCTCTGAAAATACTGAATTTGCAGAACTGTGTAAGAAAGAGCGCATCATTTTTATTGGTCCACCTTCATCTGCTATTCGGGATATGGGGATTAAGAGCACTTCAAAGGCAATTATGTCTGCAGCTGGTGTTCCAGTTATTGAAGGCTACCACGGTGAGGACCAGTCTGACCAGCACCTTAAGGAACAGGCTGGGAAAATAGGCTATCCTGTAATGATTAAAGCAGTTCGTGGAGGAGGTGGCAAGGGAATGAGAATTGCACAATGTGAAGATGATTTTTTGGAACAGTTGGAATCTGCACGTAGAGAGGCAAAAAAGTCCTTCAATGATGATGTTATGCTGATTGAGAAGTTTGTTCAAAATCCAAGGCATGTAGAAGTTCAAGTGTTTGGGGACCAGCATGGAAATGCAGTGTATTTATTCGAAAGAGATTGCAGTGTGCAAAGGAGACACCAGAAAATTATTGAAGAAGCTCCAGGGCCAGGAATTAGTACGGAAGTTAGAAGGAAACTTGGTGAAGCAGCAGTAAGGGCAGCAAAAGCCGTGAATTACGTGGGTGCAGGAACCGTGGAGTTCATAATGGACTCTAAGCATAATTTTTACTTTATGGAAATGAACACGCGTCTACAAGTTGAGCACCCTGTCACTGAGATGATCACAGGAACAGATTTGGTAGAATGGCAGCTCCGGGTTGCAGCTGGAGAGAGGATTCCTATGACTCAGGATGAAATCACCCTCCAGGGTCACGCATTTGAAGCACGGATATATGCTGAAGATCCTGATAATAACTTTATGCCTGGAGCAGGTCCCTTGCTGCATCTTTCTACTCCACTGAGCAATGATTTTACTCGCATTGAAACTGGAGTCAGACAAGGTGATGAAGTTTCGGTTCACTATGATCCCATGATAGCCAAACTAGTTGTATGGGGCGAGGATCGTCAAGCAGCACTGATGAAGCTAAAGTACTGCCTTCGCCAGTATAATATTGTTGGCTTGAGTACCAACATTGATTTTCTGCTAAGTTTATCTGGACATCCAGCCTTTGAATCAGGAGATGTACACACAGATTTTATTCCCCAGCATTATAATGAGCTCTTCCCACCTAAGAAATCAACACCTAGAGAAGTACTATGCCAAGCTGCTCTTGGCCTTATTCTGAAGGAGAAACTTCTAACCAAGGAGTTCAGTATAGCGACTGGGGACCCTTTCTCCCCATTTGCTTTCAGTAATGGGAGAAGAATAAATGTTTCTCACACCAGGAGCCTCAGTTTATTTGATGGAGAAAATAAATTGGAATTGAAAATACATTATAACAATGATGGATCATATGATATACAGATACAAGATGAAGTGCTGAATGTTTCAGGAGAACTTGTCAGTGAGGGAGATGTCACATACCTGGAATGTTCAGTCAATGGAGTAATGAGCAAGCCCAAACTAGTTATTGTGGATAACACAATATATCTCTTCTCACGGGAAGGCAGTGCACAACTTGGGATTCCAGTACCAAGATATTTGTCAGATGTCAGCACTACAGGACCACAAGGAGGGGCTGTAGCACCCATGACAGGAACTATAGAAAAGGTGTTTGTAAAAGTTGGTGACAATGTGGAAGTTGGGGACCCTGTCATGGTTATGATTGCTATGAAAATGGAGCATACAATACGGGCACCTAAACCAGGCACAATAAAAAAGGTTTACTTTAAGGAGGGTGAGCAAGTCAGCAGGCATGCTCTACTTGTGGAGTTTGAAGATGAAGAATCTGGATCAGAATGA
Full Trace Sequence: gacagtatcctgaatgccaactaaaagcgtaaaatagacccatcgcatatagctgccgcacagatggttatctggtttaacatatcgctagtatcgtgtacagctgattgtggtttttgaggaataacctgttaaagaaatcaacatggcggccaccttgatacttctgagggggagaacctgtcctggcttctgtgtgcttctgcaccagcggaaatggacctgtggccccaaactaatcagatatgcttcagaaacaggaagaagtaaaatcgagaaagtcctcattgcaaacagaggggagattgcctgcagggtgatgcgcactgctaagaagatgggtgtacggtctgtagcagtttacagtgaagcagacaggaacactatgcatgtctccttggcagatgaagcatatttaattggtccggctgcttcacaacagagttaccttgctatggataaaatattgcaagtagcaaagaggtcaggagcacaggctattcaccctggttatggtttcctctctgaaaatactgaatttgcagaactgtgtaagaaagagcgcatcatttttattggtccaccttcatctgctattcgggatatggggattaagagcacttcaaaggcaattatgtctgcagctggtgttccagttattgaaggctaccacggtgaggaccagtctgaccagcaccttaaggaacaggctgggaaaataggctatcctgtaatgattaaagcagttcgtggaggaggtggcaagggaatgagaattgcacaatgtgaagatgattttttggaacagttggaatctgcacgtagagaggcaaaaaagtccttcaatgatgatgttatgctgattgagaagtttgttcaaaatccaaggcatgtagaagttcaagtgtttggggaccagcatggaaatgcagtgtatttattcgaaagagattgcagtgtgcaaaggagacaccagaaaattattgaagaagctccagggccaggaattagtacggaagttagaaggaaacttggtgaagcagcagtaagggcagcaaaagccgtgaattacgtgggtgcaggaaccgtggagttcataatggactctaagcataatttttactttatggaaatgaacacgcgtctacaagttgagcaccctgtcactgagatgatcacaggaacagatttggtagaatggcagctccgggttgcagctggagagaggattcctatgactcaggatgaaatcaccctccagggtcacgcatttgaagcacggatatatgctgaagatcctgataataactttatgcctggagcaggtcccttgctgcatctttctactccactgagcaatgattttactcgcattgaaactggagtcagacaaggtgatgaagtttcggttcactatgatcccatgatagccaaactagttgtatggggcgaggatcgtcaagcagcactgatgaagctaaagtactgccttcgccagtataatattgttggcttgagtaccaacattgattttctgctaagtttatctggacatccagcctttgaatcaggagatgtacacacagattttattccccagcattataatgagctcttcccacctaagaaatcaacacctagagaagtactatgccaagctgctcttggccttattctgaaggagaaacttctaaccaaggagttcagtatagcgactggggaccctttctccccatttgctttcagtaatgggagaagaataaatgtttctcacaccaggagcctcagtttatttgatggagaaaataaattggaattgaaaatacattataacaatgatggatcatatgatatacagatacaagatgaagtgctgaatgtttcaggagaacttgtcagtgagggagatgtcacatacctggaatgttcagtcaatggagtaatgagcaagcccaaactagttattgtggataacacaatatatctcttctcacgggaaggcagtgcacaacttgggattccagtaccaagatatttgtcagatgtcagcactacaggaccacaaggaggggctgtagcacccatgacaggaactatagaaaaggtgtttgtaaaagttggtgacaatgtggaagttggggaccctgtcatggttatgattgctatgaaaatggagcatacaatacgggcacctaaaccaggcacaataaaaaaggtttactttaaggagggtgagcaagtcagcaggcatgctctacttgtggagtttgaagatgaagaatctggatcagaatgattatttttcttttcttgtgtttttacaagaaagtataaatataatgtatatttacaattcaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MAATLILLRGRTCPGFCVLLHQRKWTCGPKLIRYASETGRSKIEKVLIANRGEIACRVMRTAKKMGVRSVAVYSEADRNTMHVSLADEAYLIGPAASQQSYLAMDKILQVAKRSGAQAIHPGYGFLSENTEFAELCKKERIIFIGPPSSAIRDMGIKSTSKAIMSAAGVPVIEGYHGEDQSDQHLKEQAGKIGYPVMIKAVRGGGGKGMRIAQCEDDFLEQLESARREAKKSFNDDVMLIEKFVQNPRHVEVQVFGDQHGNAVYLFERDCSVQRRHQKIIEEAPGPGISTEVRRKLGEAAVRAAKAVNYVGAGTVEFIMDSKHNFYFMEMNTRLQVEHPVTEMITGTDLVEWQLRVAAGERIPMTQDEITLQGHAFEARIYAEDPDNNFMPGAGPLLHLSTPLSNDFTRIETGVRQGDEVSVHYDPMIAKLVVWGEDRQAALMKLKYCLRQYNIVGLSTNIDFLLSLSGHPAFESGDVHTDFIPQHYNELFPPKKSTPREVLCQAALGLILKEKLLTKEFSIATGDPFSPFAFSNGRRINVSHTRSLSLFDGENKLELKIHYNNDGSYDIQIQDEVLNVSGELVSEGDVTYLECSVNGVMSKPKLVIVDNTIYLFSREGSAQLGIPVPRYLSDVSTTGPQGGAVAPMTGTIEKVFVKVGDNVEVGDPVMVMIAMKMEHTIRAPKPGTIKKVYFKEGEQVSRHALLVEFEDEESGSE
Donor tissue: