ORFeome > mcfp – XORFeome 2.0

mcfp – XORFeome 2.0

General Information

Species: Xenopus tropicalis mitochondrial carrier family protein, mRNA (cDNA clone MGC:76123 IMAGE:5309058), complete cds
Gene Symbol: mcfp
Gene ID: 394941
ORF gb_acc: MG132747
ORF ID: 10050

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC064218

Library Location

Plate ID: GDExt11001
Well Location: C06

EST Sequences

Clone: MGC:76123 IMAGE:5309058
Trimmed Sequence: ATGCAGAAAAATACGGAACCAGTGCAGGAAGCTATTAACATTACCCCCAGCCAACAGATGATTGCATCTTCCATGGGAGCCCTCCTCACATCTTTCTTCGTTACACCTCTGGATGTAGTGAAGATTCGGCTACAGGCTCAAAGCAAACCTTTTATAAAAGGAAAATGCTTTGTTTATTGCAATGGTTTAATGGATCATCTGTGCCTATGTACAAATGGGAATGGAAAAGCATGGTATAGAGCACCTGGCCATTTCCGAGGGACCACGGATGCTTTTGTCCAGATAATAAGGAATGAAGGAATCAAGTCCTTGTGGAGCGGCCTACCTCCTACTCTTGTCATGGCAGTGCCGGCCACAGTCATTTATTTTACATGCTATGATCAGCTACGGGACATTTTGATTCGCAGTATGCCAGAAAGGGCAGAAATTGCTTCTCTGGTTGCTGGAGCCACTGCTAGATTGTGGTCAGCAACATTAATTAGCCCACTGGAACTGATAAGAACCAAGATGCAGTACAGACCACTGTCCTATAAGGAGCTCAGGCAATGTATCCAAAGTTCGGTGGCAAAAGATGGCTGGCTCGCACTCTGGAAAGGATGGGGACCCACTGTGCTTCGAGATGTCCCTTTCTCTGCACTGTACTGGCACAACTATGAACTTGTGAAGCAGTCATTATGTCAGAGATACAACACCTTGCAGCCAACGTTTGCGATCAGTTTTACAGCTGGTGCTGTGTCTGGCTCAATTGCAGCAATAGTCACTTTGCCTTTTGATGTTGTGAAAACAAGAAGACAAGTTGAGGTTGGGGAGCTAGAGATGTTCACCTATTCTCAGAAAAGATCCTCATCAACATGGAAGCTGATGAGGGCTATAGTGATTGAGAATGGCTTTGGGGGGCTGTTTGCTGGTCTTATACCCCGATTAATTAAGGTTGCACCCGCCTGCGCCATAATGATCAGCACCTATGAATTTGGAAAGTCGTTTTTTCGTAAGCTAAATAATGAACGTCAGCTGAAAAGCTTATGA
Full Trace Sequence: ggctgtcacgggttgctccgcgttactcgttgatatataagatacagaccaagtataaggtcacgaaacaaactattttgtgaatctttgccctagtcaatcatggcgccctaggcttgcagggccctcccctgggcaggagctgcgtgtgcttgtgtaatagtacagtaaccggcatgtcctgcgcttggcactctcacatgcttctgtaggagaggggattcttccatgtgcgattgcccgccggcttctattggagagaatgggctgtgagcctcctgctctgcggtgagcgaagtccattatggcggccctctgtcctaagcgcctataaggacataccttgtggctggtttcaaggagcaaaatgcagaaaaatacggaaccagtgcaggaagctattaacattacccccagccaacagatgattgcatcttccatgggagccctcctcacatctttcttcgttacacctctggatgtagtgaagattcggctacaggctcaaagcaaaccttttataaaaggaaaatgctttgtttattgcaatggtttaatggatcatctgtgcctatgtacaaatgggaatggaaaagcatggtatagagcacctggccatttccgagggaccacggatgcttttgtccagataataaggaatgaaggaatcaagtccttgtggagcggcctacctcctactcttgtcatggcagtgccggccacagtcatttattttacatgctatgatcagctacgggacattttgattcgcagtatgccagaaagggcagaaattgcttctctggttgctggagccactgctagattgtggtcagcaacattaattagcccactggaactgataagaaccaagatgcagtacagaccactgtcctataaggagctcaggcaatgtatccaaagttcggtggcaaaagatggctggctcgcactctggaaaggatggggacccactgtgcttcgagatgtccctttctctgcactgtactggcacaactatgaacttgtgaagcagtcattatgtcagagatacaacaccttgcagccaacgtttgcgatcagttttacagctggtgctgtgtctggctcaattgcagcaatagtcactttgccttttgatgttgtgaaaacaagaagacaagttgaggttggggagctagagatgttcacctattctcagaaaagatcctcatcaacatggaagctgatgagggctatagtgattgagaatggctttggggggctgtttgctggtcttataccccgattaattaaggttgcacccgcctgcgccataatgatcagcacctatgaatttggaaagtcgttttttcgtaagctaaataatgaacgtcagctgaaaagcttatgatttaagtttgggcagtggctcaagcatgtccgcagtgcctgtaaatggattatgtgttactaaaatgccttctgtgaatctgaaaggaacagcccaggttatagattttcctatagcagtagtccagatactagcatgttacattctgccttgtgttctcacacgtgatccctgagaagattttatttttaatgttgactcactaaacttttttaacgttttcttatttttttttttaataaatcctcctttcccccagtccagtcagtatttgtttattcttataatattaggggggaatggatgggacagtagcctcacagatgcgggttcatagtcttatatgggtgctgtctagcacagtactagagtaattggtaatggaagagagcaggcattatataaattccctttgcttgcctataaattaagaaccatgtcatagctgctcaagcatcatcctttggctttaggtccatcccttcattaatttgtgccatagaactgttgtttcctgtcagatgtcaaacttgtggcagctcttctgctgtttctacagttcacgtgtgttagctgaggatgtaaataaactgaatttctgaggaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MQKNTEPVQEAINITPSQQMIASSMGALLTSFFVTPLDVVKIRLQAQSKPFIKGKCFVYCNGLMDHLCLCTNGNGKAWYRAPGHFRGTTDAFVQIIRNEGIKSLWSGLPPTLVMAVPATVIYFTCYDQLRDILIRSMPERAEIASLVAGATARLWSATLISPLELIRTKMQYRPLSYKELRQCIQSSVAKDGWLALWKGWGPTVLRDVPFSALYWHNYELVKQSLCQRYNTLQPTFAISFTAGAVSGSIAAIVTLPFDVVKTRRQVEVGELEMFTYSQKRSSSTWKLMRAIVIENGFGGLFAGLIPRLIKVAPACAIMISTYEFGKSFFRKLNNERQLKSL
Donor tissue: gastrula