ORFeome > mcm7 – XORFeome 2.0

mcm7 – XORFeome 2.0

General Information

Species: Xenopus tropicalis mcm7 protein, mRNA (cDNA clone MGC:75610 IMAGE:5379288), complete cds
Gene Symbol: mcm7
Gene ID: 407945
ORF gb_acc:
ORF ID: 10962

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC067307

Library Location

Plate ID: GDExt11009
Well Location: C10

EST Sequences

Clone: MGC:75610 IMAGE:5379288
Trimmed Sequence: ATGCCCAGGGATTACCAAGCCGAGAAAGAGAAGTGCAAGACCTTTCTGCAGGAGTTTTACAAAGATGACGAGCTTGGGAAGAAGAACTTCAAGTATGGAGTCCAGCTGGCTAATATTGCTCACAGAGAGCAGGTTGCGCTGTACATCGATCTGGATGACCTGGCCGAGGAGGACCCCGAGTTAGTGGATGCAATCTGTGAAAACACAAGGAGGTACACAAACCTGTTTGCTGATGCCGTTCAGGAGCTGCTGCCCCAGTATAAAGAGCGAGAGGTGGTACATAAAGATGCTTTGGATGTGTATATTGAGCACCGCTTAATGATGGAGCAGAGAGGCCGAGACCCCAGTGAGACCCGTGATCCTCACAACCAGTACCCCCCAGAGCTTATGCGCAGATTCGAACTGTACTTCAAAGCTCCGAGCAGCTCAAAAGCCCGCGTGGTGCGAGATGTCAAAGCCGATTCCATCGGCAAGTTGGTTACAGTTCGGGGCATAGTCACGAGGGTCACAGAAGTCAAGCCTATGATGGTGGTGGCAACATACACATGTGACCAGTGTGGTGCCGAGACCTACCAACCGATTCAATCTCCAACTTTTATGCCGCTTATAATGTGTCCCAGCAGGGAGTGTCAGACAAACCGCTCTGGGGGCAGGCTCTACTTGCAGACCCGGGGCTCTAAATTTATTAAGTTCCAAGAGCTGAAGATTCAAGAACATAGTGATCAAGTTCCAGTTGGGAACATCCCTCGCTGTATGTCTGTGTATGTACGTGGGGAGAACACGCGGCTCGCTCAGCCCGGGGACCATGTCAGTATCACTGGAGTCTTCCTGCCGATGCTAAGAACTGGCTTCCGTCAGGTGGTACAGGGGCTCCTTTCAGAGACGTACCTCGAATCTCACCGTTTGGTGAAAATGAACAAGACCGAGGATGATGAACTCGGAACAGAAGAGCTGAGTGAAGAGGAGCTGCGACAGATTACTGAGGAAGATTTCTATGAGAAGCTGGCAGCCTCCATTGCGCCTGAGATTTATGGGCACGAGGATGTGAAGAAGGCTCTACTTCTGCTCTTAGTGGGAGGAGTTGACAATTCTCCCCGTGGCATGAAGATAAGAGGGAACATTAACATCTGCCTGATGGGTGACCCAGGAGTTGCAAAATCACAGCTGCTTTCTTATATTGATCGTCTAGCACCTCGGAGTCAGTACACAACAGGTCGCGGCTCCTCCGGGGTGGGTCTCACCGCAGCGGTAATGAAAGACCCAGTGACTGGCGAGATGACACTGGAAGGCGGAGCTTTGGTACTGGCGGATCAGGGGGTTTGCTGCATTGATGAGTTTGATAAGATGATGGACACGGACAGAACAGCCATTCATGAAGTCATGGAGCAGCAGACTATCTCCATAGCCAAGGCTGGCATAATGACCACTCTAAATGCTCGCTGCTCTATTCTTGCTGCTGCTAACCCTGCCTACGGGAGGTACAACCCAAAGAAGACAGTGGAGCAGAATATCCAGCTCCCTGCTGCCTTACTGTCCCGATTCGACCTACTCTGGCTGATCCAAGACAAGCCGGACAGGGACAACGATCTCAGACTGGCGCAGCACATTACATACGTCCATCAGCACAGCAAGCAGCCGCCATCACAGTTTCAGCCTCTGGATATGAAACTTATGCGACGTTACATTACTATGTGCAAGCGCAAGCAGCCTGCAATCCCAGAATCCCTTGCAGACTATCTGACGGCTGCCTACGTGGAAATGAGAAAAGAAGCCCGAACCAACAAAGACATGACTTTCACTTCTGCCCGAACCCTGCTGTCTATTCTGAGATTGTCTACAGCCTTGGCTCGTCTGCGTCTGGAAGATGTCGTGGAGAAAGAGGATGTAAACGAGGCCATGAGGTTGACTGAAATGTCTAAGGACTCGTTGCTTGGCGACAAGGGGCAAACGTCAAGGACGCAACGCCCGGCCGACGTGATCTTCTCCACTATCCGAGAGATGGTCCCGGAGAAAGGCGCCCGCAGCGTCAAATACTCGGAGGCGGAGCAGCGCGCCGTGTCTAAAGGCTTCACCCCCGCCCAGTTCGAGGCGGCTCTGGAGGAGTACGAGGAGCTGAACGTCTGGCTGGTTAATCAGGCCCGCACCAAGATCACATTTGTGTAA
Full Trace Sequence: cggagagtgaggcagtagcagcgagttaccatcatgcccagggattaccaagccgagaaagagaagtgcaagacctttctgcaggagttttacaaagatgacgagcttgggaagaagaacttcaagtatggagtccagctggctaatattgctcacagagagcaggttgcgctgtacatcgatctggatgacctggccgaggaggaccccgagttagtggatgcaatctgtgaaaacacaaggaggtacacaaacctgtttgctgatgccgttcaggagctgctgccccagtataaagagcgagaggtggtacataaagatgctttggatgtgtatattgagcaccgcttaatgatggagcagagaggccgagaccccagtgagacccgtgatcctcacaaccagtaccccccagagcttatgcgcagattcgaactgtacttcaaagctccgagcagctcaaaagcccgcgtggtgcgagatgtcaaagccgattccatcggcaagttggttacagttcggggcatagtcacgagggtcacagaagtcaagcctatgatggtggtggcaacatacacatgtgaccagtgtggtgccgagacctaccaaccgattcaatctccaacttttatgccgcttataatgtgtcccagcagggagtgtcagacaaaccgctctgggggcaggctctacttgcagacccggggctctaaatttattaagttccaagagctgaagattcaagaacatagtgatcaagttccagttgggaacatccctcgctgtatgtctgtgtatgtacgtggggagaacacgcggctcgctcagcccggggaccatgtcagtatcactggagtcttcctgccgatgctaagaactggcttccgtcaggtggtacaggggctcctttcagagacgtacctcgaatctcaccgtttggtgaaaatgaacaagaccgaggatgatgaactcggaacagaagagctgagtgaagaggagctgcgacagattactgaggaagatttctatgagaagctggcagcctccattgcgcctgagatttatgggcacgaggatgtgaagaaggctctacttctgctcttagtgggaggagttgacaattctccccgtggcatgaagataagagggaacattaacatctgcctgatgggtgacccaggagttgcaaaatcacagctgctttcttatattgatcgtctagcacctcggagtcagtacacaacaggtcgcggctcctccggggtgggtctcaccgcagcggtaatgaaagacccagtgactggcgagatgacactggaaggcggagctttggtactggcggatcagggggtttgctgcattgatgagtttgataagatgatggacacggacagaacagccattcatgaagtcatggagcagcagactatctccatagccaaggctggcataatgaccactctaaatgctcgctgctctattcttgctgctgctaaccctgcctacgggaggtacaacccaaagaagacagtggagcagaatatccagctccctgctgccttactgtcccgattcgacctactctggctgatccaagacaagccggacagggacaacgatctcagactggcgcagcacattacatacgtccatcagcacagcaagcagccgccatcacagtttcagcctctggatatgaaacttatgcgacgttacattactatgtgcaagcgcaagcagcctgcaatcccagaatcccttgcagactatctgacggctgcctacgtggaaatgagaaaagaagcccgaaccaacaaagacatgactttcacttctgcccgaaccctgctgtctattctgagattgtctacagccttggctcgtctgcgtctggaagatgtcgtggagaaagaggatgtaaacgaggccatgaggttgactgaaatgtctaaggactcgttgcttggcgacaaggggcaaacgtcaaggacgcaacgcccggccgacgtgatcttctccactatccgagagatggtcccggagaaaggcgcccgcagcgtcaaatactcggaggcggagcagcgcgccgtgtctaaaggcttcacccccgcccagttcgaggcggctctggaggagtacgaggagctgaacgtctggctggttaatcaggcccgcaccaagatcacatttgtgtaatggcggaagcctgggtgggcgggatgttacatgtatctgcccccctctatcatctgcagggctgcaactgtgctcattttgttttattaatgccaaaagaattggatgtgagtggtattggcaggtgtgtttaatatccgacacggactggtcaccgtaatcccttctgcctcaacgtgaaccccggatcttccggataaggagactgatttctctgtaaatagttataccatgtggtctctgaagaaccttcaataaagattttttagtagaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MPRDYQAEKEKCKTFLQEFYKDDELGKKNFKYGVQLANIAHREQVALYIDLDDLAEEDPELVDAICENTRRYTNLFADAVQELLPQYKEREVVHKDALDVYIEHRLMMEQRGRDPSETRDPHNQYPPELMRRFELYFKAPSSSKARVVRDVKADSIGKLVTVRGIVTRVTEVKPMMVVATYTCDQCGAETYQPIQSPTFMPLIMCPSRECQTNRSGGRLYLQTRGSKFIKFQELKIQEHSDQVPVGNIPRCMSVYVRGENTRLAQPGDHVSITGVFLPMLRTGFRQVVQGLLSETYLESHRLVKMNKTEDDELGTEELSEEELRQITEEDFYEKLAASIAPEIYGHEDVKKALLLLLVGGVDNSPRGMKIRGNINICLMGDPGVAKSQLLSYIDRLAPRSQYTTGRGSSGVGLTAAVMKDPVTGEMTLEGGALVLADQGVCCIDEFDKMMDTDRTAIHEVMEQQTISIAKAGIMTTLNARCSILAAANPAYGRYNPKKTVEQNIQLPAALLSRFDLLWLIQDKPDRDNDLRLAQHITYVHQHSKQPPSQFQPLDMKLMRRYITMCKRKQPAIPESLADYLTAAYVEMRKEARTNKDMTFTSARTLLSILRLSTALARLRLEDVVEKEDVNEAMRLTEMSKDSLLGDKGQTSRTQRPADVIFSTIREMVPEKGARSVKYSEAEQRAVSKGFTPAQFEAALEEYEELNVWLVNQARTKITFV
Donor tissue: tailbud