ORFeome > mest – XORFeome 2.0

mest – XORFeome 2.0

General Information

Species: Xenopus tropicalis mesoderm specific transcript homolog, mRNA (cDNA clone MGC:89010 IMAGE:7004449), complete cds
Gene Symbol: mest
Gene ID: 448261
ORF gb_acc: MG134161
ORF ID: 11794

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC075327

Library Location

Plate ID: GDExt11017
Well Location: C08

EST Sequences

Clone: MGC:89010 IMAGE:7004449
Trimmed Sequence: ATGAAGGAATGGTGGATTCAAGTTGGACTGCTAACAGTTCCCTTCCTGGCTGTGTATCTGCACATCCCTCCTCCTAACTTCTCCCCGGCACTATTCACATGGAGGTCAACAGGGGCATTCTTTACTTTTAAGGAGCAACAGATTTTCTACAGAGATTCTTGGGGGGCTGTTGGCAGCTCAGATGTTGTCATTCTTTTGCATGGATTTCCTACCTCAAGCTATGACTGGTACAAGATTTGGGAAGGTCTTACCCAGAGATTCCATCGAGTGATTGCTCTGGATTTTATAGGGTTCGGTTTCAGTGACAAGCCAAGACTCCACCGATATTCTATTTTTGAACAAGCTAGTATTGTGGAGGCAATGATTGGCCACCTTGGCTTGAGAGATCAGAAAGTAAACCTCCTGTCCCATGATTATGGAGATACAGTTGCCCAAGAACTGCTCCACAGGTATAATCACAGAAGAAAAGGATATATAAATATAGGAAGTTTATGTCTCTCTAATGGAGGTATCTTCCCAGAGACACACTATCCCAGATTTATTCAGAAGCTGCTAAAAGATGGTGGAATCTTTTCACCAATCCTCACAAGGCTTATGAACTTTTATTTCTTCACTAAAGGAATAAGCGAGGTGTTTGGTCCTCATACACAACCCTCAGAGGCAGAGTACTGGGACATGTGGACTGCCCTTAGGACCAATGAAGGGAACCTGGTGATAGACAGTGTCTTGCAGTTCATAAACCAGCGAAGTAAGCACAGAGACCGATGGGTTGGGGCATTAATCAATACAACAGTTCCATTGCATCTTATTTATGGACCCTTGGATCCTGTAAATCCACACCCTGAGTTTATAGAACATTACAAAAACATGATTCCAAAATCAACATTCAGTATTCTAGATGACCATATTAGTCACTACCCCCAGCTGGAGGATCCCACTGGCTTCTTAAATGCCTATTTGAACTTCATTAATTCATTCTGA
Full Trace Sequence: ggaaaactgactggcgcctctgtctttttgcaaagaatcctggctgagcaggatgaaggaatggtggattcaagttggactgctaacagttcccttcctggctgtgtatctgcacatccctcctcctaacttctccccggcactattcacatggaggtcaacaggggcattctttacttttaaggagcaacagattttctacagagattcttggggggctgttggcagctcagatgttgtcattcttttgcatggatttcctacctcaagctatgactggtacaagatttgggaaggtcttacccagagattccatcgagtgattgctctggattttatagggttcggtttcagtgacaagccaagactccaccgatattctatttttgaacaagctagtattgtggaggcaatgattggccaccttggcttgagagatcagaaagtaaacctcctgtcccatgattatggagatacagttgcccaagaactgctccacaggtataatcacagaagaaaaggatatataaatataggaagtttatgtctctctaatggaggtatcttcccagagacacactatcccagatttattcagaagctgctaaaagatggtggaatcttttcaccaatcctcacaaggcttatgaacttttatttcttcactaaaggaataagcgaggtgtttggtcctcatacacaaccctcagaggcagagtactgggacatgtggactgcccttaggaccaatgaagggaacctggtgatagacagtgtcttgcagttcataaaccagcgaagtaagcacagagaccgatgggttggggcattaatcaatacaacagttccattgcatcttatttatggacccttggatcctgtaaatccacaccctgagtttatagaacattacaaaaacatgattccaaaatcaacattcagtattctagatgaccatattagtcactacccccagctggaggatcccactggcttcttaaatgcctatttgaacttcattaattcattctgaaggagggaagtgtgtttatattttgtgattctgcgcaggctcatttggaatatcaccatttgcaagggtgtcatttggaactgagcggcggcaatatgatgatacatcagtttaatgacaactcattgttcacttgattcttatgtgaggaatacctaactctgcatgtgtctcagggactgctgttctatattctatcaagaggcctttatttgtatttatatcacatattgatggtcttgtaatatgctttcttagtggctgaggccacctgccaattcagagcagtcagcagcctatattaatttgggtgtggtattgtttttatagaccaccatggaatctttcttatatcatttcttaggaaatggcctgaaactcttccaatgcaaagaggtatgtccgttgatacagatgcagttgagcaatacaaataatctctttacactggacttttgaactgtgtgcatacagacctacagcaatagtaaatacagaacatatgcagtgaaaaaaggcagtcagcacttcaacccttttctactttagaaatgcgaaaaaaaggactgtcataatttcttagctcctatttctactctgtgaatgaaagcttaaccagttctttaatgccagttatagtatttttttgagaaatgatttgaaatcacagtataaaaattcaatttcactcgattttaaaacagacataatgaacagggctcctacagacagtgttcaaaaatgcttaagggatcaagtttaaaaaattgagtattttcttgaatagttgaaatgttcttcatctcattgttaacttggcacgatatacaaatttagctaccgccacatccaaaataatagaagaatgatacaatcatgcagttgtagttatacaatttgttagtactattatcatatagcaaagatgatgtaaattacatagatatgtatattcatctatataatctgtatctaaattccaaaaatgagatttctaaattgagcatgctaatccccctgccctatgccaaatatcttatttaaatctgtactttcattctttgtatagtttacagtacttttatacctggcaaattttcaagattgtttttaatgtttaacggagattaaaattctaatgtttataaaataaactgaaaagattttttaactaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MKEWWIQVGLLTVPFLAVYLHIPPPNFSPALFTWRSTGAFFTFKEQQIFYRDSWGAVGSSDVVILLHGFPTSSYDWYKIWEGLTQRFHRVIALDFIGFGFSDKPRLHRYSIFEQASIVEAMIGHLGLRDQKVNLLSHDYGDTVAQELLHRYNHRRKGYINIGSLCLSNGGIFPETHYPRFIQKLLKDGGIFSPILTRLMNFYFFTKGISEVFGPHTQPSEAEYWDMWTALRTNEGNLVIDSVLQFINQRSKHRDRWVGALINTTVPLHLIYGPLDPVNPHPEFIEHYKNMIPKSTFSILDDHISHYPQLEDPTGFLNAYLNFINSF
Donor tissue: