ORFeome > mgc108040 – XORFeome 2.0

mgc108040 – XORFeome 2.0

General Information

Species: Xenopus tropicalis hypothetical protein mgc108040, mRNA (cDNA clone MGC:108040 IMAGE:7002734), complete cds
Gene Symbol: mgc108040
Gene ID: 613095
ORF gb_acc: MG134592
ORF ID: 12315

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC098078

Library Location

Plate ID: GDExt11022
Well Location: A10

EST Sequences

Clone: MGC:108040 IMAGE:7002734
Trimmed Sequence: ATGGCAACAGGGGGTTCCATTGTTAGGGGGGTCACCGCCCCAAGAGGCTGCGCCATGGACGAGTCTGAGGGACCCGAAGAGAAGGAGGAGACTGAATCATGGATCCCTGTGCAGAGGGAGCGATCCTACACCTCGGGGTCCCTGTCTGAGAGCTCTGGGCTGAAGAGGAGGAAGCAGGTGGAGCCCCCCCCAGGCCAGGTGGCAGAGGAGAAGGAGCCCAGCAGCAAGAGGGTTAAACCTGTCTCCAAAACACTGTCTGCATCTGGGGCCCCGCCCCCGGCTAAAGTCACGCCCCTCAAGAAACTCAGCCTGTCCATCCAGAAATCCATTGGCTGTAAGAGTGAGAGCCGCCTGTTCAGCTTCCCTCCCCGAACCCGCAGCCGGGAGCCTGGGGGCGGGGCCAAGAGGCGGAGCAGCAAGCTGTGGCGGGAAACCTTCGACAGTGCAGGGGAGGAGCTATCAGCGCGGGAAATCAAACGGCAGGAGGTGATCTTTGAGCTGATGCAGGGGGAGCACACACTCATAGAGGATCTCAACTTGGTCAGAAAGAATTACTATGAGCCTATGTTAAAGCTGGAGATCTTATCCCGGGAGGAGCTGGAGCAGATCTTTGGGATCCTGGACTCGCTGGCCCCCCTGCACCAAGATCTCCTGGAGCGGCTCCTGAAGTTGAGGCTGGAGGATGGTACGTTGGAGGTAATTGGGCCGACCATGTTGGAATGGCTGCCCTGTCTCCATGCCTACAAGACCTACTGCTGCAACCAAGTGGCCGCTAAGTCCCTGCTGGACCACAAGAGGCGCTGTGCCGCCGTCCAGAACTTCCTGCGCTTGTGCCAGGAGTCGGCCTTTAGCCGCAAGTTGGACGTCTGGAGCTTCCTGGATCTGCCCCGGAGCCGCCTCGTCAAGTACCCCCTTCTGCTCAAAGAGCTGCTCAAGCACACGGGCCCAGAACATCCTGACTATACACCGCTGGGGGAGGCTGTGTGTATGATCCAAACCATCGTTAGCCTAATTAACAGCAAGACGGGGGAGGCTGAGTGTGAGTACTACCGGCGGAGGCTGACCTACCTGTACGAGAGCCAAGAGGAAGGGGCGGTGACTTCCTCCCGACTCCTGCACTGCCATGGGGAGCTCAAGAACAACAAGGGCCAGAGGCTCCAGGTGTTCCTGTTTGAGGCGGCCCTGGTCCTGACTCGGCCAATCACGCAGAACCATCAGCTGCAGTTCCAGGTGTATCGCCAGCCCATCCCCCTGCAGGAACTGGTTCTGGAGGACTTGCCCGATGGAGAAGTGCGAGTGGGGGGCTCCATACGAGGGGCTTTCACACCTGCTACAGAACGGGCCAAGAACTTCTTCCGGGTGAGTTTCCAGGACCGGTCCCGGGGCCAATCCCACACCCTGCAGGCCAACGACTCCTTCAATAAGCAGCAGTGGGTCAGCTGCATCCGCCAGGCCAAGGCGGCCAATCAGAGGGGCAGTACTTCCCCGGGGGGGCCCCCGGAACCCCCCTGCACCCTGGTGGACATCTCTGATCTGAGCCTGAGCTCCATTGAGGACTGTGAGAAAATGGAGGATGGGTAA
Full Trace Sequence: ggggaggaaatgtcgctgcctctgcaccccgagctctggtgggagcactcaggcacccgctgcaaccgggacactcgccggggtctcggggggcccgacagggggcaccatggcaacagggggttccattgttaggggggtcaccgccccaagaggctgcgccatggacgagtctgagggacccgaagagaaggaggagactgaatcatggatccctgtgcagagggagcgatcctacacctcggggtccctgtctgagagctctgggctgaagaggaggaagcaggtggagccccccccaggccaggtggcagaggagaaggagcccagcagcaagagggttaaacctgtctccaaaacactgtctgcatctggggccccgcccccggctaaagtcacgcccctcaagaaactcagcctgtccatccagaaatccattggctgtaagagtgagagccgcctgttcagcttccctccccgaacccgcagccgggagcctgggggcggggccaagaggcggagcagcaagctgtggcgggaaaccttcgacagtgcaggggaggagctatcagcgcgggaaatcaaacggcaggaggtgatctttgagctgatgcagggggagcacacactcatagaggatctcaacttggtcagaaagaattactatgagcctatgttaaagctggagatcttatcccgggaggagctggagcagatctttgggatcctggactcgctggcccccctgcaccaagatctcctggagcggctcctgaagttgaggctggaggatggtacgttggaggtaattgggccgaccatgttggaatggctgccctgtctccatgcctacaagacctactgctgcaaccaagtggccgctaagtccctgctggaccacaagaggcgctgtgccgccgtccagaacttcctgcgcttgtgccaggagtcggcctttagccgcaagttggacgtctggagcttcctggatctgccccggagccgcctcgtcaagtacccccttctgctcaaagagctgctcaagcacacgggcccagaacatcctgactatacaccgctgggggaggctgtgtgtatgatccaaaccatcgttagcctaattaacagcaagacgggggaggctgagtgtgagtactaccggcggaggctgacctacctgtacgagagccaagaggaaggggcggtgacttcctcccgactcctgcactgccatggggagctcaagaacaacaagggccagaggctccaggtgttcctgtttgaggcggccctggtcctgactcggccaatcacgcagaaccatcagctgcagttccaggtgtatcgccagcccatccccctgcaggaactggttctggaggacttgcccgatggagaagtgcgagtggggggctccatacgaggggctttcacacctgctacagaacgggccaagaacttcttccgggtgagtttccaggaccggtcccggggccaatcccacaccctgcaggccaacgactccttcaataagcagcagtgggtcagctgcatccgccaggccaaggcggccaatcagaggggcagtacttccccgggggggcccccggaacccccctgcaccctggtggacatctctgatctgagcctgagctccattgaggactgtgagaaaatggaggatgggtaaagcattggttttaccccccagggcaacagaatgtgacaagtaatgcgccaccctgaacccacttacccgccgcttcctgcgccccagaacccgccccccctgcgccccagaacccgccccccctgcgccccagaacccgccccccctgcgccccagaacccgccccccctgcgccccagaacccgcccccccgtcagcctttcactgtatttaaaataaatctttcctattttttcaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MATGGSIVRGVTAPRGCAMDESEGPEEKEETESWIPVQRERSYTSGSLSESSGLKRRKQVEPPPGQVAEEKEPSSKRVKPVSKTLSASGAPPPAKVTPLKKLSLSIQKSIGCKSESRLFSFPPRTRSREPGGGAKRRSSKLWRETFDSAGEELSAREIKRQEVIFELMQGEHTLIEDLNLVRKNYYEPMLKLEILSREELEQIFGILDSLAPLHQDLLERLLKLRLEDGTLEVIGPTMLEWLPCLHAYKTYCCNQVAAKSLLDHKRRCAAVQNFLRLCQESAFSRKLDVWSFLDLPRSRLVKYPLLLKELLKHTGPEHPDYTPLGEAVCMIQTIVSLINSKTGEAECEYYRRRLTYLYESQEEGAVTSSRLLHCHGELKNNKGQRLQVFLFEAALVLTRPITQNHQLQFQVYRQPIPLQELVLEDLPDGEVRVGGSIRGAFTPATERAKNFFRVSFQDRSRGQSHTLQANDSFNKQQWVSCIRQAKAANQRGSTSPGGPPEPPCTLVDISDLSLSSIEDCEKMEDG
Donor tissue: