ORFeome > MGC69286 – XORFeome 2.0

MGC69286 – XORFeome 2.0

General Information

Species: Xenopus tropicalis MGC69286 protein, mRNA (cDNA clone MGC:69286 IMAGE:5308466), complete cds
Gene Symbol: MGC69286
Gene ID: 448020
ORF gb_acc: MG133184
ORF ID: 10647

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC074536

Library Location

Plate ID: GDExt11006
Well Location: H08

EST Sequences

Clone: MGC:69286 IMAGE:5308466
Trimmed Sequence: ATGGCGTCTTTTACCGAACCGGCCCTGGAAAAGAAGCTGTCGGAGCTGAGCAACTCGCAGCAGAGTGTCCAGACGCTGTCGCTGTGGCTGATCCACCACCGAAAGCACGCTGCGTCTATTGTGACGGTGTGGCAGCGGGAGCTCCGGAAAGCCAAGTCAAGCCGGAAGCTGACTTTCTTGTACTTGGCCAATGATGTTATTCAGAACAGCAAACGAAAAGGACCAGAATTCACCCGCGAGTTTGAAAATGTGCTCTTGGATGCCTTCTCGCATGTGTCCAGCGAGGCAGAGGATGGGTGCCGGAAGCCTTTGGAAAGGTTGCTGCATATCTGGCAGGAACGCAGCGTTTACTCGGCTGATTTTATCCAACAGCTCCGACTGTCAATCGAAAATGATGAGAGCCCCAGGGAAACACCAGTTAACGAAGAGAAATCACTGAAACGCACCTTCCAGCAAATACAAGAGGAAGATGATGATTATCCAGGCAACTACTCCCCTCGGGATACTTCTGCCGGACCCCTTTTGACAGAAGATTTGATCAAAGCTCTGCAAGATCTAGAGAATGCAGCGTCCGGAGATGCCGCCGTCAGGCAGAAGATTGCATCGCTCCCACAGGAGGTGCAAGATGTCTCCTTGTTGGAAAAAATCACAGATAAGGAGGCGGCAGAGCGTCTATCCAAGACCGTGGACGAGGCTTGCATATTACTAGCTGAATACAATGGGCGGCTAGCAGCAGAACTGGATGATCGCAGGCAGTTAGCAAAGATGCTGATGGAGTATACACAGGCTCAGAAGGAAACTCTCAGCAACAAGGAGAAGAAGCTTGAGGAATACAAGCAAAAACTAGCACGGGTAACGCAAGTTCGGAAAGAACTGAAATCGCACATACAGAGCCTCCCAGACCTGTCGCTGCTTCCGAATGTAACCGGGGGGCTGGCGCCGCTCCCCTCTGCCGGAGACCTTTTCTCTACCGAATGA
Full Trace Sequence: ggggtgagaggtgaggcggccatcttgttctgggccggtgggggcctcccagcgggtaaacatggcgtcttttaccgaaccggccctggaaaagaagctgtcggagctgagcaactcgcagcagagtgtccagacgctgtcgctgtggctgatccaccaccgaaagcacgctgcgtctattgtgacggtgtggcagcgggagctccggaaagccaagtcaagccggaagctgactttcttgtacttggccaatgatgttattcagaacagcaaacgaaaaggaccagaattcacccgcgagtttgaaaatgtgctcttggatgccttctcgcatgtgtccagcgaggcagaggatgggtgccggaagcctttggaaaggttgctgcatatctggcaggaacgcagcgtttactcggctgattttatccaacagctccgactgtcaatcgaaaatgatgagagccccagggaaacaccagttaacgaagagaaatcactgaaacgcaccttccagcaaatacaagaggaagatgatgattatccaggcaactactcccctcgggatacttctgccggaccccttttgacagaagatttgatcaaagctctgcaagatctagagaatgcagcgtccggagatgccgccgtcaggcagaagattgcatcgctcccacaggaggtgcaagatgtctccttgttggaaaaaatcacagataaggaggcggcagagcgtctatccaagaccgtggacgaggcttgcatattactagctgaatacaatgggcggctagcagcagaactggatgatcgcaggcagttagcaaagatgctgatggagtatacacaggctcagaaggaaactctcagcaacaaggagaagaagcttgaggaatacaagcaaaaactagcacgggtaacgcaagttcggaaagaactgaaatcgcacatacagagcctcccagacctgtcgctgcttccgaatgtaaccggggggctggcgccgctcccctctgccggagaccttttctctaccgaatgagagcgacgacttccctccctacagcgccgctccactctctcctagaagttccactagacaccagcaaagaggagattgtagagccaagccagactggaacccctattccttgctgtgtggattgcgtgatgccactgctgagtgcagtctagaagcttagacgtaacagtcgcagtgccctccctctgtagtgcccagcgctgacggacgccattgcgcagagtggctttagccttcctagacctctgttctttttggttttttttaagacttgtttataaatagtgcaaatgaattcttctatctccaatcagctttctccggcggctttgactctctcccccggttgctttttaacacatacagtaaacgagtgattttgttttcagcactgatggtttccttgtaatgtgctgcaggaaccaaacacaatatagagtcatttcagtaccaaaaacaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MASFTEPALEKKLSELSNSQQSVQTLSLWLIHHRKHAASIVTVWQRELRKAKSSRKLTFLYLANDVIQNSKRKGPEFTREFENVLLDAFSHVSSEAEDGCRKPLERLLHIWQERSVYSADFIQQLRLSIENDESPRETPVNEEKSLKRTFQQIQEEDDDYPGNYSPRDTSAGPLLTEDLIKALQDLENAASGDAAVRQKIASLPQEVQDVSLLEKITDKEAAERLSKTVDEACILLAEYNGRLAAELDDRRQLAKMLMEYTQAQKETLSNKEKKLEEYKQKLARVTQVRKELKSHIQSLPDLSLLPNVTGGLAPLPSAGDLFSTE
Donor tissue: gastrula