ORFeome > MGC69303 – XORFeome 2.0

MGC69303 – XORFeome 2.0

General Information

Species: Xenopus tropicalis MGC69303 protein, mRNA (cDNA clone MGC:69303 IMAGE:5308623), complete cds
Gene Symbol: MGC69303
Gene ID: 448051
ORF gb_acc: MG133188
ORF ID: 10651

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC074573

Library Location

Plate ID: GDExt11006
Well Location: E12

EST Sequences

Clone: MGC:69303 IMAGE:5308623
Trimmed Sequence: ATGTTCCGAGCGGTCAGTCGGGCGGGGAGCCTCCTGCTGCGGGGCTCCCAAGTACATTACCCCAGAACGTGGAATAGAGAGGCCCAGCGGTGCTTGTCCTCCGGCCTCCCCATGAACACCGTCGTGCTGTTTGTGCCCCAGCAGGAGGCCTGGGTGATAGAACGAATGGGGCGCTTCCACCGCATACTGGAGCCTGGCCTGAATGTGCTCATCCCTATCCTGGATCGGATCCGCTACGTGCAGAGCCTGAAGGAAATCGTCATCAATGTCCCCGAGCAGTCGGCGGTGTCACTCGATAACGTCACCCTGCAGATAGACGGGGTTCTGTACCTCCGGATCATGGACCCATACAAGGCAAGTTACGGGGTGGAGGACCCGGAATACGCAGTCACCCAGTTGGCACAGACCACCATGCGCTCTGAGTTGGGCAAACTGACTCTGGACAAGGTCTTCAGGGAGAGAGAATCCCTCAATGCCAACATCGTGGATGCAATAAACCAGGCATCGGACTACTGGGGCATCAAGTGCCTGAGATACGAGATCAAGGACATCCACGTCCCCCCCAAGGTCAAGGAAGCCATGCAGATGCAGGTGGAGGCGGAGAGAAGGAAGAGGGCGATGGTGCTGGAGTCTGAGGGGACCAGAGAGTCGGCCATAAATGTGGCAGAAGGACAGAAGCAAGCCCAGATCCTGGCCTCCGAGGCTGAGCGGGCAGAGCAGATAAATAAAGCTGCGGGTGAGGCCAATGCCATCCTGGCGAAAGCAAAGGCTCGCGGAGACGCCATCCGGATGCTGGCAGAGGCCCTGACACAGCAGAATGGCAATGCAGCCGCCTCCCTCACCGTGGCTGAGCAGTACGTGTTGGCCTTCTCCAAGCTCGCCAAGGAATCCAACACCATTCTACTTCCAACCAACACCGGAGACATAAGCAGCATGGTGGCCCAGGCAATGGGCATTTATGGGAAAATGACCCAGCAGCAGTTAGCGCAGAGCAGCCCCACCCTGAGTGACGGCACAATGGGCACCGAGACACAAGGGCAGAGCCAGAGTTAG
Full Trace Sequence: gggaagggacaggccgggcagtgccgggcacacaggagcggggagcggcatgttccgagcggtcagtcgggcggggagcctcctgctgcggggctcccaagtacattaccccagaacgtggaatagagaggcccagcggtgcttgtcctccggcctccccatgaacaccgtcgtgctgtttgtgccccagcaggaggcctgggtgatagaacgaatggggcgcttccaccgcatactggagcctggcctgaatgtgctcatccctatcctggatcggatccgctacgtgcagagcctgaaggaaatcgtcatcaatgtccccgagcagtcggcggtgtcactcgataacgtcaccctgcagatagacggggttctgtacctccggatcatggacccatacaaggcaagttacggggtggaggacccggaatacgcagtcacccagttggcacagaccaccatgcgctctgagttgggcaaactgactctggacaaggtcttcagggagagagaatccctcaatgccaacatcgtggatgcaataaaccaggcatcggactactggggcatcaagtgcctgagatacgagatcaaggacatccacgtcccccccaaggtcaaggaagccatgcagatgcaggtggaggcggagagaaggaagagggcgatggtgctggagtctgaggggaccagagagtcggccataaatgtggcagaaggacagaagcaagcccagatcctggcctccgaggctgagcgggcagagcagataaataaagctgcgggtgaggccaatgccatcctggcgaaagcaaaggctcgcggagacgccatccggatgctggcagaggccctgacacagcagaatggcaatgcagccgcctccctcaccgtggctgagcagtacgtgttggccttctccaagctcgccaaggaatccaacaccattctacttccaaccaacaccggagacataagcagcatggtggcccaggcaatgggcatttatgggaaaatgacccagcagcagttagcgcagagcagccccaccctgagtgacggcacaatgggcaccgagacacaagggcagagccagagttagccgtgcaactgaacctcgtggctgccagccgggactcttacctctatacaatgtcgggctcattgattattttttttaatggaatttcatttatgtaatatattattattgggaaaaaaaaaagaaaaataaaagaacatcttacaataaataaaaataaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MFRAVSRAGSLLLRGSQVHYPRTWNREAQRCLSSGLPMNTVVLFVPQQEAWVIERMGRFHRILEPGLNVLIPILDRIRYVQSLKEIVINVPEQSAVSLDNVTLQIDGVLYLRIMDPYKASYGVEDPEYAVTQLAQTTMRSELGKLTLDKVFRERESLNANIVDAINQASDYWGIKCLRYEIKDIHVPPKVKEAMQMQVEAERRKRAMVLESEGTRESAINVAEGQKQAQILASEAERAEQINKAAGEANAILAKAKARGDAIRMLAEALTQQNGNAAASLTVAEQYVLAFSKLAKESNTILLPTNTGDISSMVAQAMGIYGKMTQQQLAQSSPTLSDGTMGTETQGQSQS
Donor tissue: gastrula