ORFeome > MGC69304 – XORFeome 2.0

MGC69304 – XORFeome 2.0

General Information

Species: Xenopus tropicalis hypothetical protein MGC69304, mRNA (cDNA clone MGC:69304 IMAGE:5308628), complete cds
Gene Symbol: MGC69304
Gene ID: 407967
ORF gb_acc:
ORF ID: 11926

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC067929

Library Location

Plate ID: GDExt11019
Well Location: B06

EST Sequences

Clone: MGC:69304 IMAGE:5308628
Trimmed Sequence: ATGAAGGTGAAGGTTCTGTGCAGGAACCCGGACGATTATGTTCGAGAAACCAAGAGAGACTTGCAGAGAGTTCCTCGCAATTATGACCCAGCCCTACACCCATTTGAAGTGCCACGGGAATATACAAGAGCATTAAATGCCACCAAGCTGGAGCGTGTCTTTGCAAAACCCTTTATTGCCTCCCTGGACGGCCATAGAGATGGGGTTAATTGCATTGCTAAGCATCCCAAGAGCTTATCTACTGTGCTGTCAGGAGCCTGTGATGGAGAGGTTAAGATTTGGAATTTGACGAAGCGAGAATGTTCCAGAACAATACAAGCGCATGATGGCTTTGTGAGAGGACTTTGCGTCCGGTTCTGTGGTACCTCGTTCTTTACAGTGGGTGACGATAAGACAGTAAAGCAATGGTCTATGGAAAGCCCTGGTTATGGTGAGAAAGTGGAGCCCATACGTACAATTCTAGGGAAGACAGTTTTTACAGGGATTGACCATCACATGAATGATGCTATTTTTGCCACTTGTGGGCAGCAAGTGGACATCTGGGATGAACAGAGGTCCGCTCCCATGAGATCTTATGCATGGGGTGTCGACAGCATCTCATCCATCAAATTTAATCCAATAGAGACCCACATTTTGTCAAGCTGCGGAACAGACAGGAGCATTGTTCTCTATGATAAACGCAAACCCACCCCATTAAAAAAGATTATTTTGGAAATGAGAACAAATACCCTGTGTTGGAATCCCATGGAAGCTTTTATCTTTACTGCAGCTAATGAAAACTTCAACCTGTACACGTACGACATGCGCTATATGGACGGCCCGGTGAAGGTGCACATGGATCACGTATCCGCAGTTCTGGATGTTGATTACTCTCCTACCGGAAAGGAGTTTGTGTCTGCCAGCTTTGATAAGTCCATCCGAATATTCCCCGTGCAAAGTGGACACAGCAGGGAAGTCTATCACACAAAGCGTATGCAGCACGTCACCTGCGTCAGATGGTCTGCTGACAACAAGTATGTTCTTTGCGGCTCTGATGAAATGAACATCCGTATATGGAAAGCCAACGCGTCAGAGAAACTGGGCCTGTTGTCACCACGAGAGAGAGCGGCACAGAACTACAACCAGAAGTTGAAGGAGAAGTTCCATCACCACCCCCAGATCAAGAGGATAGCGCGTCACCGGCACCTACCAAGGTCCATCTACAGCCAAATAAAGGAGCAGCAAATTATGAGGGAAGCCCGTCGCAAGAAGGATGTAAATCGTCGGAAACACAGCAAGCCGGGCTCTGTGCCAATCCCGTCGGAGAAGAAGAAGCACGTGCTGGCTGTTGTGGAATAG
Full Trace Sequence: gtggggaaattgttgacatagaacgcgggttaccatgaaggtgaaggttctgtgcaggaacccggacgattatgttcgagaaaccaagagagacttgcagagagttcctcgcaattatgacccagccctacacccatttgaagtgccacgggaatatacaagagcattaaatgccaccaagctggagcgtgtctttgcaaaaccctttattgcctccctggacggccatagagatggggttaattgcattgctaagcatcccaagagcttatctactgtgctgtcaggagcctgtgatggagaggttaagatttggaatttgacgaagcgagaatgttccagaacaatacaagcgcatgatggctttgtgagaggactttgcgtccggttctgtggtacctcgttctttacagtgggtgacgataagacagtaaagcaatggtctatggaaagccctggttatggtgagaaagtggagcccatacgtacaattctagggaagacagtttttacagggattgaccatcacatgaatgatgctatttttgccacttgtgggcagcaagtggacatctgggatgaacagaggtccgctcccatgagatcttatgcatggggtgtcgacagcatctcatccatcaaatttaatccaatagagacccacattttgtcaagctgcggaacagacaggagcattgttctctatgataaacgcaaacccaccccattaaaaaagattattttggaaatgagaacaaataccctgtgttggaatcccatggaagcttttatctttactgcagctaatgaaaacttcaacctgtacacgtacgacatgcgctatatggacggcccggtgaaggtgcacatggatcacgtatccgcagttctggatgttgattactctcctaccggaaaggagtttgtgtctgccagctttgataagtccatccgaatattccccgtgcaaagtggacacagcagggaagtctatcacacaaagcgtatgcagcacgtcacctgcgtcagatggtctgctgacaacaagtatgttctttgcggctctgatgaaatgaacatccgtatatggaaagccaacgcgtcagagaaactgggcctgttgtcaccacgagagagagcggcacagaactacaaccagaagttgaaggagaagttccatcaccacccccagatcaagaggatagcgcgtcaccggcacctaccaaggtccatctacagccaaataaaggagcagcaaattatgagggaagcccgtcgcaagaaggatgtaaatcgtcggaaacacagcaagccgggctctgtgccaatcccgtcggagaagaagaagcacgtgctggctgttgtggaatagcacaaactgctgatactgacttactgttgtacatctcccgcatcccgctgctcttctgggcaatatagtgcgggtcgttgtggcctgggaaaaggacttgacatgcccaagtcccaagggggctggtttcaggtatccagtaaaatctgaatggacctttcttggaatcgccctgagaatgttttttttttttttttcatcaaattagaattgtgtgcaaggttataggagggttaaggaaatacagatcactcgaatagaaggtgtagtctaaatatggagggcttatttttaatccttcctgcctggtggcccccagcagagtaaaaggggcccattcctttgtccccacaagacctgaacaagaaagagctctctgaaaaaacaattccagagatttagttggtagatatgtggaggaggaaagggaaagatatttctgtagaagaggagaaatggaggtgttaggctataacactttctcaccagttcacattcatctgacttttaaaatcccacccttccctttgttacttctaaaaatatgtttgttttcttctccctgccctcctattctttatccaaactgcctgctgctaagggatgcagggagttatagctggatggggggcacataataaagaaccttgcaatgttaaaaaaaaaaaaaaaaaaaaaaaaaaagaaaaaaaaaaagcaacaaaaaaaaaaaaaaaaa
Translation: MKVKVLCRNPDDYVRETKRDLQRVPRNYDPALHPFEVPREYTRALNATKLERVFAKPFIASLDGHRDGVNCIAKHPKSLSTVLSGACDGEVKIWNLTKRECSRTIQAHDGFVRGLCVRFCGTSFFTVGDDKTVKQWSMESPGYGEKVEPIRTILGKTVFTGIDHHMNDAIFATCGQQVDIWDEQRSAPMRSYAWGVDSISSIKFNPIETHILSSCGTDRSIVLYDKRKPTPLKKIILEMRTNTLCWNPMEAFIFTAANENFNLYTYDMRYMDGPVKVHMDHVSAVLDVDYSPTGKEFVSASFDKSIRIFPVQSGHSREVYHTKRMQHVTCVRWSADNKYVLCGSDEMNIRIWKANASEKLGLLSPRERAAQNYNQKLKEKFHHHPQIKRIARHRHLPRSIYSQIKEQQIMREARRKKDVNRRKHSKPGSVPIPSEKKKHVLAVVE
Donor tissue: gastrula