ORFeome > MGC69308 – XORFeome 2.0

MGC69308 – XORFeome 2.0

General Information

Species: Xenopus tropicalis hypothetical protein MGC69308, mRNA (cDNA clone MGC:69308 IMAGE:5308658), complete cds
Gene Symbol: MGC69308
Gene ID: 407930
ORF gb_acc: MG133235
ORF ID: 10710

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC067973

Library Location

Plate ID: GDExt11006
Well Location: B12

EST Sequences

Clone: MGC:69308 IMAGE:5308658
Trimmed Sequence: ATGCGCAGGAGTGACCGGTTACGGTGTGCCGGTGCTTCGCTGCTAGTGGTCTTATGCGGCGTGTTCCGTTCCTCCTTTGGCGGCAGAACACTACCAGCCCTCAGTGATGACATCCCATTCCGGCTCAAGTGGCCCGGGCCAGACTTCACTCTGCCTACAGCAGGTATACCCTACAAAGAGGATAACTACATCATCATGACCACTGCTGACAAAGAAAAATATAAGTGTTTGCTTCCTCTAATGGCCAATGGAAATGAGGAACAAGATGGTGAATACAAAGGGCCTAGCCCTGGTGCACTACTGGAGCCACTCTTCAAACTAAGCAGCTGCTCATACAGGATTGAATCATACTGGACATATGAGGTGTGCCATGGAAAGTACATTCGGCAGTACCATGAAGAGAAAGAAACTGGGCAGAAATTGAGCATACAAGAGTATTATCTGGGAAAGATGATGAAAAAGAGCACTACAGAAGCAGGTGAAAACCAGGAAGAGAAAGAGAGTACAGAAAGCCCTAAAGAAATTTATACAAAAAACATTGAAGGGCAGATGACACCATACTATCCAGTAGAGATGATAAATGGGACACCATGCAGTTTGAAACAGAACCAACCGCGGAGCAGCACAGTCATGTATATATGCCACCCTGAGTCAAAACATGAAATCCTGTCTGTAGCTGAAGTAACCACGTGCGAATATGAAGTTGTGATACTGACTCCCCTGTTGTGCAATCACCCTAAATACAGGTTTAGAACTTCACCTATAAATGACATATTTTGCCAGTCGATGCCAGGGTCGCCACTACGACCCCAGAGCCTGGTGAAACTTGAGCACCAGAAGGAAGAAATCAAATCTCCATTAAAACCCAACAAAGAGGAAGAACAGCAGTTGCTGAGAGAGAAGTTCTCCACGATTCACAAGCCGGTCACAGTGGGATCTCAGCAGCAAGTAACTGTGGGAACTACTCACATCTCCAGGCTGACGGATGAGCAACTGATTAAAGAGTTTCTTAGTGGTTCCTATTGTTTTCATGGGGGCGTTGGTTGGTGGAAATATGAATTCTGCTACGGAAAATATGTGCATCAGTATCATGAGGATAAGGACACTGGAAAAACCACGGTTGTTGTTGGAACATGGAAAGCTGATGAGCACCAAGAATGGGCTAAAAAGAACCTTGCAAGAGCGTACATGACAACACCCGATGGAGTCCAAACTGTAAAAACTGTATCCCATTTCTATGGTGGTGGAGATGTGTGTGAAGTAAGTGAGCAGCCAAGACAAGTAATTGTGAAATTAAAGTGCAAAGAGTCCGAGTCCCCTCACGCTGTTACTGTATATATGCTTGAGCCACAGACCTGCCAGTACATTCTCGGGGTGGAATCTCCAGTAATATGTAAAATTTTAGATACCGCAGATGAGAACGGACTCCTTTCAATTCCCAACTGA
Full Trace Sequence: tcgggatagcggctgcttctccgtgccgcggagagaatgcgcaggagtgaccggttacggtgtgccggtgcttcgctgctagtggtcttatgcggcgtgttccgttcctcctttggcggcagaacactaccagccctcagtgatgacatcccattccggctcaagtggcccgggccagacttcactctgcctacagcaggtataccctacaaagaggataactacatcatcatgaccactgctgacaaagaaaaatataagtgtttgcttcctctaatggccaatggaaatgaggaacaagatggtgaatacaaagggcctagccctggtgcactactggagccactcttcaaactaagcagctgctcatacaggattgaatcatactggacatatgaggtgtgccatggaaagtacattcggcagtaccatgaagagaaagaaactgggcagaaattgagcatacaagagtattatctgggaaagatgatgaaaaagagcactacagaagcaggtgaaaaccaggaagagaaagagagtacagaaagccctaaagaaatttatacaaaaaacattgaagggcagatgacaccatactatccagtagagatgataaatgggacaccatgcagtttgaaacagaaccaaccgcggagcagcacagtcatgtatatatgccaccctgagtcaaaacatgaaatcctgtctgtagctgaagtaaccacgtgcgaatatgaagttgtgatactgactcccctgttgtgcaatcaccctaaatacaggtttagaacttcacctataaatgacatattttgccagtcgatgccagggtcgccactacgaccccagagcctggtgaaacttgagcaccagaaggaagaaatcaaatctccattaaaacccaacaaagaggaagaacagcagttgctgagagagaagttctccacgattcacaagccggtcacagtgggatctcagcagcaagtaactgtgggaactactcacatctccaggctgacggatgagcaactgattaaagagtttcttagtggttcctattgttttcatgggggcgttggttggtggaaatatgaattctgctacggaaaatatgtgcatcagtatcatgaggataaggacactggaaaaaccacggttgttgttggaacatggaaagctgatgagcaccaagaatgggctaaaaagaaccttgcaagagcgtacatgacaacacccgatggagtccaaactgtaaaaactgtatcccatttctatggtggtggagatgtgtgtgaagtaagtgagcagccaagacaagtaattgtgaaattaaagtgcaaagagtccgagtcccctcacgctgttactgtatatatgcttgagccacagacctgccagtacattctcggggtggaatctccagtaatatgtaaaattttagataccgcagatgagaacggactcctttcaattcccaactgacgtgtaaatgaagtaaaacagtcttccaggaccctgtaattagtacataatggcagactgagcactgtacaaaggagaatgaatatgagccatcctgtttatatgtatgtgtgtatatattgcataatacagaaacgttttaaatatgacaatctgttataaagttctcacttgtttttaaaaaaaaaaaaaaa
Translation: MRRSDRLRCAGASLLVVLCGVFRSSFGGRTLPALSDDIPFRLKWPGPDFTLPTAGIPYKEDNYIIMTTADKEKYKCLLPLMANGNEEQDGEYKGPSPGALLEPLFKLSSCSYRIESYWTYEVCHGKYIRQYHEEKETGQKLSIQEYYLGKMMKKSTTEAGENQEEKESTESPKEIYTKNIEGQMTPYYPVEMINGTPCSLKQNQPRSSTVMYICHPESKHEILSVAEVTTCEYEVVILTPLLCNHPKYRFRTSPINDIFCQSMPGSPLRPQSLVKLEHQKEEIKSPLKPNKEEEQQLLREKFSTIHKPVTVGSQQQVTVGTTHISRLTDEQLIKEFLSGSYCFHGGVGWWKYEFCYGKYVHQYHEDKDTGKTTVVVGTWKADEHQEWAKKNLARAYMTTPDGVQTVKTVSHFYGGGDVCEVSEQPRQVIVKLKCKESESPHAVTVYMLEPQTCQYILGVESPVICKILDTADENGLLSIPN
Donor tissue: gastrula