ORFeome > MGC69365 – XORFeome 2.0

MGC69365 – XORFeome 2.0

General Information

Species: Xenopus tropicalis MGC69365 protein, mRNA (cDNA clone MGC:69365 IMAGE:5309399), complete cds
Gene Symbol: MGC69365
Gene ID: 448036
ORF gb_acc: MG133327
ORF ID: 10827

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC074556

Library Location

Plate ID: GDExt11007
Well Location: A09

EST Sequences

Clone: MGC:69365 IMAGE:5309399
Trimmed Sequence: ATGACCAAAAGATCAAAGTTGCGTGAACAAGTTTTGGAGTCTGACCTTACTTGGAAGAAAATAACTCAATTTATCACTGGCAATGTGGACAAGAAGGAGCATGAAGAAATAAAAGAGAACTTTAAAGAAATATTACAGGCGGCGAAACAGATTGTGGGTACTGACCATGGTCAAGAAGCAATTGAAAGTGGAGCATCATACCTTTTCAAGATTTTCAATGATAAGGATGGTATTGGCCAGATTGAGACTATGGCTATCAAACAAATGTTTGGACCTTTTCCATCTTCATCTGCTACAGCAGCATTCAATGCAATATATAATATTGTGTCCAGGCTTAATGAGGACAAACTAAAGAAGCTTCTACTTCTTTTCGGGGAACAAAGGGATGAAGGTTCAGAATTCTTTGGAAAAAATCTGAATTTTTCATTAGACATGTACGCACTAGAGGAGACCGAGGATATGCCTTTAAACTGGAATACTGAAACCAAAGACATAAGTTTGGATTTTAGAAAATTTCATAGTGATCACATAGAAACACCTGATGGCACATCTGGCGGCCAGGCAAGACACAACAGAACTTATGAAACTGAGGATGACAGTTCATTTCTATATGATGAAGTGAAGAAATATGTTATGCATAACTTACAAAGCAGTTCTGGTGGTCCCACAGTTAATGATTTGTGTAGTACTTTATTTGAGATGCTTGCATCTACCAAAAGTAATGATGAGCTTCAGAATGAGTTGTTTGAACTCTTGGGCCCTGAAGGGTTAACCTTCATTGAAATGTTACTTCAGCAAAGGCAAAAAATTGTGGAGAGATCTCTGAACTACGATAACAAAATGTATACGTCTCAAGAGCAGCGCATGAGAAATTATGGGGAAAACACAAAACCTAATTATGGATGTCAAGTTACCGTTCAGTCTGAGCAGGAGAAGCAGCTAATGAAACAGTATCGTCGAGAAGAAAAAAGAAACAACCAAAGAACGAACGAATAA
Full Trace Sequence: ccacggtctcgcgtgatgagacttgcggtgccgggttttctgtaagacagcaaaggagcttgctattaacagcttgtgggacctaaacgtggacagaacagccccttgggcacgattgctgaggcagcaattgcttgttccttccagaggaagggtacctgtcaccctcagaaaaaaatccaaattcttttctatcagctcttccacgtggcagcagaatctaatttttcatcctatggatcactgaataaggaagagatggttttacctcgtctcacaggagctctgcgttctttttcaaatgtcaccaggcaagatgattacaggggagactcgtcagacctgatgaccaaaagatcaaagttgcgtgaacaagttttggagtctgaccttacttggaagaaaataactcaatttatcactggcaatgtggacaagaaggagcatgaagaaataaaagagaactttaaagaaatattacaggcggcgaaacagattgtgggtactgaccatggtcaagaagcaattgaaagtggagcatcataccttttcaagattttcaatgataaggatggtattggccagattgagactatggctatcaaacaaatgtttggaccttttccatcttcatctgctacagcagcattcaatgcaatatataatattgtgtccaggcttaatgaggacaaactaaagaagcttctacttcttttcggggaacaaagggatgaaggttcagaattctttggaaaaaatctgaatttttcattagacatgtacgcactagaggagaccgaggatatgcctttaaactggaatactgaaaccaaagacataagtttggattttagaaaatttcatagtgatcacatagaaacacctgatggcacatctggcggccaggcaagacacaacagaacttatgaaactgaggatgacagttcatttctatatgatgaagtgaagaaatatgttatgcataacttacaaagcagttctggtggtcccacagttaatgatttgtgtagtactttatttgagatgcttgcatctaccaaaagtaatgatgagcttcagaatgagttgtttgaactcttgggccctgaagggttaaccttcattgaaatgttacttcagcaaaggcaaaaaattgtggagagatctctgaactacgataacaaaatgtatacgtctcaagagcagcgcatgagaaattatggggaaaacacaaaacctaattatggatgtcaagttaccgttcagtctgagcaggagaagcagctaatgaaacagtatcgtcgagaagaaaaaagaaacaaccaaagaacgaacgaataacgaaagaataaaacaaaagaaaaaacaaataaaccaaaaaaaaagaaaaaaaaagaaaaaaaaaaaaaaaaa
Translation: MTKRSKLREQVLESDLTWKKITQFITGNVDKKEHEEIKENFKEILQAAKQIVGTDHGQEAIESGASYLFKIFNDKDGIGQIETMAIKQMFGPFPSSSATAAFNAIYNIVSRLNEDKLKKLLLLFGEQRDEGSEFFGKNLNFSLDMYALEETEDMPLNWNTETKDISLDFRKFHSDHIETPDGTSGGQARHNRTYETEDDSSFLYDEVKKYVMHNLQSSSGGPTVNDLCSTLFEMLASTKSNDELQNELFELLGPEGLTFIEMLLQQRQKIVERSLNYDNKMYTSQEQRMRNYGENTKPNYGCQVTVQSEQEKQLMKQYRREEKRNNQRTNE
Donor tissue: gastrula