ORFeome > MGC69373 – XORFeome 2.0

MGC69373 – XORFeome 2.0

General Information

Species: Xenopus tropicalis MGC69373 protein, mRNA (cDNA clone MGC:69373 IMAGE:5335185), complete cds
Gene Symbol: MGC69373
Gene ID: 594955
ORF gb_acc: MG134248
ORF ID: 11909

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC090607

Library Location

Plate ID: GDExt11019
Well Location: C01

EST Sequences

Clone: MGC:69373 IMAGE:5335185
Trimmed Sequence: ATGGACATGAAAAAACGAATCCACCTGGAGCTGAGGAACAGGACGCCGTCTGATGTACGAGAATTGGTTCTGGATAACTGCCGGGCGCATGAAGGCAAAATAGAGGGTCTTACAGCAGAGTTTGTGAATCTAGAATTCCTCAGCTTAATAAATGTCTTATTGATGTCAGTCTCAAATCTTCCAAAGCTCCCCAAATTAAAAAAGCTTGAGCTGAGTGACAACAGAATCTCTGGAGGTCTGGATGTACTAGCAGAAAAATTATCAAACCTCACACATCTAAATCTCAGTGGAAATAAAATAAAGGACATTAGCACATTGGAACCTCTGAAAAAATTAGAGTCTTTGAAAAGCCTGGACCTATTCAACTGTGAAGTAACAAATTTAAATGACTACAGAGAAAGTGTTTTCAAGCTCCTCCCACAACTGACTTATCTGGATGGGTATGACAGAGAAGACAAAGAGGCCCCAGATTCTGATGCTGAAGCTGATGGAGATGGTGTAGATGAGGAGGAAGAAGATGAAGAGGGTGAAGATGAGGAAGAAGATGAAGAGGAGGAAGGTGAAGAGGAAGAAGATGTAGATGAGGAGGAAGATGACGATGAAGATGAAGAGGAGATAGGGGAGGAAGAAGATGAAGAGGATGCCAGTGGTGAGGAAGAGGAAGAAGACTTTGGACATGATGGAGAAGTAGATGAAGATGATGATGAGGAGGATGATGAAGAGGATGAAGAAGAAGAAGAATCTGGCAAAGGAGAGAAAAGGAAGAGAGAAACTGATGATGATGGTGATGAAGAGGATGACTAA
Full Trace Sequence: agagagggtgctcagattgtctccttccattaaggacacctcgggctgctcttttgcaagcacagggcgcactgttcaacctccctccccctcccctccaaactttttttttttttttttttttaaataatttctgagcttgatcatctgagaaagaagagcaagtaagggacgcaggaaaagattggaaacatatatatagtcagatcggctggggggcagcacgactagaacaagaataacagttccaacaagatggacatgaaaaaacgaatccacctggagctgaggaacaggacgccgtctgatgtacgagaattggttctggataactgccgggcgcatgaaggcaaaatagagggtcttacagcagagtttgtgaatctagaattcctcagcttaataaatgtcttattgatgtcagtctcaaatcttccaaagctccccaaattaaaaaagcttgagctgagtgacaacagaatctctggaggtctggatgtactagcagaaaaattatcaaacctcacacatctaaatctcagtggaaataaaataaaggacattagcacattggaacctctgaaaaaattagagtctttgaaaagcctggacctattcaactgtgaagtaacaaatttaaatgactacagagaaagtgttttcaagctcctcccacaactgacttatctggatgggtatgacagagaagacaaagaggccccagattctgatgctgaagctgatggagatggtgtagatgaggaggaagaagatgaagagggtgaagatgaggaagaagatgaagaggaggaaggtgaagaggaagaagatgtagatgaggaggaagatgacgatgaagatgaagaggagataggggaggaagaagatgaagaggatgccagtggtgaggaagaggaagaagactttggacatgatggagaagtagatgaagatgatgatgaggaggatgatgaagaggatgaagaagaagaagaatctggcaaaggagagaaaaggaagagagaaactgatgatgatggtgatgaagaggatgactaaggcagaaaacaaaaaatagagaatgaaatgataaaggaccttaatggattatatggtattgattgaactggccccacccatggattactgataagcaggtttcagtcatagtgattaaaaacaagcccctgtccttgaaaacccaacgagccaaagagttgttactgtgacattcctaccaccaataacccctactggaagcttacaacataatttctaattaagtctgaaaaaaaggcaaaaaaaaaagacagaacttctggctaaatttcaaactttggtcaatgcttttcctattctgttggggttcctaagggtttctgagttagacctctgaggttgtatttttggagtcatggttatcagtggctacctgttaactagaagatggagcaacatttttactttctgtacaacaacgaaaaaaagagggaaaaaaaaacctttgtaaataaaatcttaacatttaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MDMKKRIHLELRNRTPSDVRELVLDNCRAHEGKIEGLTAEFVNLEFLSLINVLLMSVSNLPKLPKLKKLELSDNRISGGLDVLAEKLSNLTHLNLSGNKIKDISTLEPLKKLESLKSLDLFNCEVTNLNDYRESVFKLLPQLTYLDGYDREDKEAPDSDAEADGDGVDEEEEDEEGEDEEEDEEEEGEEEEDVDEEEDDDEDEEEIGEEEDEEDASGEEEEEDFGHDGEVDEDDDEEDDEEDEEEEESGKGEKRKRETDDDGDEEDD
Donor tissue: tailbud