ORFeome > MGC69394 – XORFeome 2.0

MGC69394 – XORFeome 2.0

General Information

Species: Xenopus tropicalis MGC69394 protein, mRNA (cDNA clone MGC:69394 IMAGE:5335337), complete cds
Gene Symbol: MGC69394
Gene ID: 448141
ORF gb_acc: MG133290
ORF ID: 10778

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC074675

Library Location

Plate ID: GDExt11007
Well Location: F07

EST Sequences

Clone: MGC:69394 IMAGE:5335337
Trimmed Sequence: ATGAAGCTCACCGATAATGTGCTCCGAAGTTTCCGTGTGGCAAAGGTCTTCCGGGAAAACTCTGATAAAATAAACTGCTTTGACTTTAGTCCAACTGGTGAAACAGTCATATCCAGCAGCGACGATGATTCAATTGTGCTTTATGATTGCCAGGAGGGGAAGCCCAAGAGGACGTTGTACAGTAAAAAATATGGTGTTGACCTTATCAGATATACACATGCAGCTAATACAGTGGTCTACAGCTCCAACAAAATTGATGACACAATACGATACCTCTCTCTTCATGATAATAAATACATCCGTTATTTCCCTGGACACAGCAAGAGAGTAGTTGCTTTGTCTATGTCTCCTGTGGATGATACGTTCATTTCTGGGTCATTGGATAAAACCATCCGGTTATGGGATCTTCGATCGCCTAACTGTCAGGGGCTAATGCATCTTCAAGGAAAACCTGTATGTTCATTTGATCCCGAGGGTCTCATTTTTGCAGCTGGAGTAAATTCAGAGATGGTCAAGTTGTATGATCTTCGCTCTTTTGATAAAGGTCCATTTGCAACCTTCAAGATGCAGTATGATCGAACCTGTGAGTGGACTGCTCTGAAATTTAGCAATGATGGGAAACTTATCTTAATGTCAACCAATGGAGGCTTCCTTCGTCTGGTTGATGCTTTTAAGGGGGCTGTTATGCACACGTTTGGGGGCTACAACAATAGTAAGGCTGTCACCCTGGAAGCTACCTTCACTCCAGATTCCCAGTTTATTATGATCGGCTCAGAAGATGGCAAAATTCATGTTTGGAATTGTGAGAGTGGTATGAAAGTAGCAGTGCTGGATGGCAAACACACAGGTCCTATCACATGCCTACAGTTCAACCCCAAGTTCATGACGTTTACTAGTGCTTGCTCAAACATGGCTTTTTGGCTACCAACTATTGATGACTGA
Full Trace Sequence: tgagaatgtaggaacgcgcgcgatccgtatgcccaaatgtcgcacaactaccaggcgccgataagctggtgatcgggaaggaacgtataaagtagcttctcttaactttcgggagggtaaatactgccattcgtaaggcccgggtcctcctgaaaacgtggctcgactcgaaaggaactgctcgttctgtctggcctatttctaaaaggggcctgctgtcccagcacattgggtcatcatgaagctcaccgataatgtgctccgaagtttccgtgtggcaaaggtcttccgggaaaactctgataaaataaactgctttgactttagtccaactggtgaaacagtcatatccagcagcgacgatgattcaattgtgctttatgattgccaggaggggaagcccaagaggacgttgtacagtaaaaaatatggtgttgaccttatcagatatacacatgcagctaatacagtggtctacagctccaacaaaattgatgacacaatacgatacctctctcttcatgataataaatacatccgttatttccctggacacagcaagagagtagttgctttgtctatgtctcctgtggatgatacgttcatttctgggtcattggataaaaccatccggttatgggatcttcgatcgcctaactgtcaggggctaatgcatcttcaaggaaaacctgtatgttcatttgatcccgagggtctcatttttgcagctggagtaaattcagagatggtcaagttgtatgatcttcgctcttttgataaaggtccatttgcaaccttcaagatgcagtatgatcgaacctgtgagtggactgctctgaaatttagcaatgatgggaaacttatcttaatgtcaaccaatggaggcttccttcgtctggttgatgcttttaagggggctgttatgcacacgtttgggggctacaacaatagtaaggctgtcaccctggaagctaccttcactccagattcccagtttattatgatcggctcagaagatggcaaaattcatgtttggaattgtgagagtggtatgaaagtagcagtgctggatggcaaacacacaggtcctatcacatgcctacagttcaaccccaagttcatgacgtttactagtgcttgctcaaacatggctttttggctaccaactattgatgactgatgcatacagagaagctggcatttgtaaaaatcccattcttcagctattttccacaaataaatcttcacaatgcccggatatatgaagaacaagaaaatggttattttttttattcttccataaaaataccccagtattgagccaacatttctctttgccaaaataagaactgttcttcggtacatatcaagatttatgaacttctgttttttaccttcatgtactgggcacttattttgtggaatggtgtatatatttttgtcatgtttctcctgacgaacctgtatttgagacacatgctaccaatctctctttttatatcctttatatacgcttccatctgtatttgttctttggagcaggatttaaatgttcactatggtaagaatccacaccaaccttgttacaccagatattacaccagaggtagatttcatggtggatgacgcactaaataaccggctaaaccagattctatttagataccctctctgtccagagttaaaggctggcaagaagctacatctgttattgttttggttaattttaagagaaattttattaatgcagtgctccttccttataggctctctctccacacctgtagttactgccacaagtattacacagatgtgcatcaaatctacacagacatattcctataacacaatcccatgttaccagaaacagcaattttgactccttcatgcagttgatttaaactggaattgctttatatcatttattattgatttctgtgtttcctttgattgttgagagatgctggatgtgtttaatagccaacgggccgcaggttaagcattgtccatctgttttctatttcaagtcagtactggtagctttgtggggaatttgcttattagtgctgccccaatttgtttagatcaggattatgattctttcattaattggttaatctatttggtaatataattcataagtagcagaacagtatatattgctctcatattctgtaagcagcattattaaacgggcattattaaactggcactagtattaagaactgcctgggttggcatccacagtaccagcactgcattggcctggctggcataggacaagtagcttctttcttgcccacagacaatcgtagctagctgaaagtgaaatacgtaggttaaagggcaatccatatataccactgaattcagcttttaagaaaacatgtggttaataaccttgttaatagaggacccaggaaaagtctgggatctgttttgtgaccacaaattggttggaaatcaaatatacacttcattttaattactttctgttgttcattatcttaaaatgagtcacataaacataccaaaagcagcattgggttcttaaccatagattaacagttcctgttgggggaatggtgatattgtttgcctcggtaaaatcactctacatagactaaaaaatagcacaatctaggagtcctagttaatgttggtttgctatcagtataatagcgttatgttttatttatataataaaaagaagccccaaactgtcatcttaaattaaaattaatgcaataccctatttggaaactaggtgtgtttggccctttaagatcttgtgtcaagtaagcagtaggtgaaaagattttacacttcaaggaaatgtgtattttacagctccagaatatgatagtttatttttaaccacacagaacctttttaaaaaaaaaaataaacaaaaatattgtatggtttcctcatgtcaaggaagcctcataagcagtattcagtatttcaaaataaagatattccacagcataaaggatttatctcactgtctcatatacatacattgaggattgtgcatgtaaataagaaatggattaaaccattactggggagctaagcagtgtgcagctgtttcttgtaaattatgtttttttacataaataaaatattaaaacaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MKLTDNVLRSFRVAKVFRENSDKINCFDFSPTGETVISSSDDDSIVLYDCQEGKPKRTLYSKKYGVDLIRYTHAANTVVYSSNKIDDTIRYLSLHDNKYIRYFPGHSKRVVALSMSPVDDTFISGSLDKTIRLWDLRSPNCQGLMHLQGKPVCSFDPEGLIFAAGVNSEMVKLYDLRSFDKGPFATFKMQYDRTCEWTALKFSNDGKLILMSTNGGFLRLVDAFKGAVMHTFGGYNNSKAVTLEATFTPDSQFIMIGSEDGKIHVWNCESGMKVAVLDGKHTGPITCLQFNPKFMTFTSACSNMAFWLPTIDD
Donor tissue: tailbud