ORFeome > MGC69434 – XORFeome 2.0

MGC69434 – XORFeome 2.0

General Information

Species: Xenopus tropicalis hypothetical protein MGC69434, mRNA (cDNA clone MGC:69434 IMAGE:5335705), complete cds
Gene Symbol: MGC69434
Gene ID: 407969
ORF gb_acc: MG133405
ORF ID: 10915

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC067946

Library Location

Plate ID: GDExt11008
Well Location: B11

EST Sequences

Clone: MGC:69434 IMAGE:5335705
Trimmed Sequence: ATGACTCACCAGTACCCAGCTCTCTCTGCTGAGCAGAAGAAGGAATTGGCAGACATCGCTCAAAAGATTGTGGCACCTGGGAAGGGCATCTTGGCTGCTGATGAATCCGTGGGGAGCATGGCCAAACGACTAAGTGGAATTGGTGTGGATAATATCGAGGAGAACAGGAGACTGTACCGTCAGTTGCTCTTCAAGGGTGACGAGCGTATGCAGGAATGTATTGGTGGTGTCATCTTCTTCCATGAGACTATGTACCAACAGGGTGACTGCGGCACCAATTTTGTCAAGATGATAAAGGACAAAGGAATTGTTGTTGGGATTAAGGTTGATAAAGGGGTGGTCCCTCTTGCTGGCACCAATGGAGAAACTACTACTCAGGGTTTGGATGGCTTGTCAGAACGCTGTGCACAGTACAAGAAGGATGGAGCTGATTTTGCCAAATGGCGTTCTGTGCTGAAGATCAGTGAGACCACTCCCTCTGCCCTTGCTATTCTGGAAAATGCTAATGTGCTTGCCCGCTATGCCAGTATCTGCCAGCAGAATGGCATTGTTCCAATTGTGGAGCCTGAAATCCTTCCTGATGGAGACCATGACCTGAAACGCTGCCAGTATGTAACTGAGAAGGTGCTCGCTGCAGTGTACAAGGCTCTCAGTGATCATCATGTATATTTGGAAGGCACTTTATTGAAACCCAATATGGTAACTGCTGGCCACGCCTGCCCAACCAAATACACTGCAGAGGAGATTGCCATGGCAACTGTAACTGCTCTGCGTCGTACTGTGCCTCCTGCTGTGCCAGGAGTTACTTTCCTATCTGGTGGACAAAGTGAAGAAGAGGCCACTATTAATCTGAATGCAATCAACAACTGCCCTCTTGCCAGACCTTGGGCTCTCACATTCTCTTATGGACGTGCCCTGCAGGCCTCTGCCCTCAGTGCCTGGCGTGGCAAGAAGGAAAATGAGGATGCAGCCACTAATGAGTTCTTGAAGCGAGCAGAGGCCAATGGTCTTGCAGCCCTCGGAAAGTATGAACAGAGCGGGGATGGATGTGGGGCAGCTGGACAGTCCCTGTATGTTGCAAACCATGCATACTGA
Full Trace Sequence: cgccgctctactcttagcgcctagcatcacccgaattcacgaaaatgactcaccagtacccagctctctctgctgagcagaagaaggaattggcagacatcgctcaaaagattgtggcacctgggaagggcatcttggctgctgatgaatccgtggggagcatggccaaacgactaagtggaattggtgtggataatatcgaggagaacaggagactgtaccgtcagttgctcttcaagggtgacgagcgtatgcaggaatgtattggtggtgtcatcttcttccatgagactatgtaccaacagggtgactgcggcaccaattttgtcaagatgataaaggacaaaggaattgttgttgggattaaggttgataaaggggtggtccctcttgctggcaccaatggagaaactactactcagggtttggatggcttgtcagaacgctgtgcacagtacaagaaggatggagctgattttgccaaatggcgttctgtgctgaagatcagtgagaccactccctctgcccttgctattctggaaaatgctaatgtgcttgcccgctatgccagtatctgccagcagaatggcattgttccaattgtggagcctgaaatccttcctgatggagaccatgacctgaaacgctgccagtatgtaactgagaaggtgctcgctgcagtgtacaaggctctcagtgatcatcatgtatatttggaaggcactttattgaaacccaatatggtaactgctggccacgcctgcccaaccaaatacactgcagaggagattgccatggcaactgtaactgctctgcgtcgtactgtgcctcctgctgtgccaggagttactttcctatctggtggacaaagtgaagaagaggccactattaatctgaatgcaatcaacaactgccctcttgccagaccttgggctctcacattctcttatggacgtgccctgcaggcctctgccctcagtgcctggcgtggcaagaaggaaaatgaggatgcagccactaatgagttcttgaagcgagcagaggccaatggtcttgcagccctcggaaagtatgaacagagcggggatggatgtggggcagctggacagtccctgtatgttgcaaaccatgcatactgagctctgcagtccactgagcactcacctacagaacagttgtcctcatcctgcaagcagcctccacttggacatcccctgcagccaaagcctggaatagtcacagccatctcctacccagcttattcccctaaccttatgttgctaatgtgatcttgaagtaatggaggtgaggttgtgagtgaatgaatcaggcttcacccacctttgcagcataatgtacctggttgtagtatattttcctaacaaaacatttatttttgtgaaagattttgctttacagccataataagaggagtgcagattgttggtaatccttctaaataggtcaatagtgtgtccattgttggacaggaaatattaacatgtggtgcagttggagataattctacggtggtatatatccagttttattattctcgtgcacaaaaacaagctgcacccaaatatctactgttcattcaatccatgacactgttctgtcttgcactttgcggtacttctataggtagatagtgtgagaagtgttgcgcttcctattccactaaaagcaggtccttcccatgttgttaggtctttggcaagtaaaatgagattagaactgaaaggagagctattgggaagggcaactaatgaatggctgtgtatcttgtgaaactagtgtgttgtctgtctctgtctgaaactgatgtaccaaatagtatgaaaataaattatatattgaaaaaaaaaaaaaaaaaaa
Translation: MTHQYPALSAEQKKELADIAQKIVAPGKGILAADESVGSMAKRLSGIGVDNIEENRRLYRQLLFKGDERMQECIGGVIFFHETMYQQGDCGTNFVKMIKDKGIVVGIKVDKGVVPLAGTNGETTTQGLDGLSERCAQYKKDGADFAKWRSVLKISETTPSALAILENANVLARYASICQQNGIVPIVEPEILPDGDHDLKRCQYVTEKVLAAVYKALSDHHVYLEGTLLKPNMVTAGHACPTKYTAEEIAMATVTALRRTVPPAVPGVTFLSGGQSEEEATINLNAINNCPLARPWALTFSYGRALQASALSAWRGKKENEDAATNEFLKRAEANGLAALGKYEQSGDGCGAAGQSLYVANHAY
Donor tissue: tailbud