ORFeome > MGC75617 – XORFeome 2.0

MGC75617 – XORFeome 2.0

General Information

Species: Xenopus tropicalis hypothetical protein MGC75617, mRNA (cDNA clone MGC:75617 IMAGE:5379328), complete cds
Gene Symbol: MGC75617
Gene ID: 395020
ORF gb_acc: MG132773
ORF ID: 10087

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC064859

Library Location

Plate ID: GDExt11002
Well Location: E03

EST Sequences

Clone: MGC:75617 IMAGE:5379328
Trimmed Sequence: ATGTTTCATTGCATCCCCCTGTGGCGGTGTAACCGTCATGTGGAGTCCGTGGATAAGAGACACTGCTCCCTGCTCGCAGTCCCGGAGGAGATTTATAGATACAGCCGGAGTCTGGAGGAGCTGCTCCTGGACGCCAACCAACTGCGGGAACTCCCCAAGCAATTTTTCCAACTTGTTAAGTTAAGAAAATTGGGCCTTAGCGACAATGAAATACAACGGCTTCCTCCAGAGATAGCAAACTTTATGCAATTGGTAGAGCTGGATGTGTCTCGAAATGAAATTCCTGAAATTCCTGAAAGCATCTCATTTTGCAAAGCACTCCAAGTAGCTGATTTTAGTGGAAATCCACTTACCAGGTTGCCTGATAGTTTCCCTGACCTTGCAAGCCTTACTTGTCTTTCCATTAATGACATCTCACTTCAGGTGCTCCCAGAAAATATTGGAAATTTATCCAACCTGGTATCTCTCGAGCTAAGAGAAAATTTGTTAACGTTTTTACCAGAATCTCTTGCGCAACTGCATAGATTAGAAGAGCTTGATATAGGAAACAATGAACTTTATAATTTGCCAGAGACCATTGGATCACTATATAAACTTAAGGACCTTTGGCTAGATGGAAATCAGCTTGCAGATTTACCTCCGGAAATAGGACATCTAAAAAATCTTCTTTGTTTGGATTTGTCTGAAAACAAACTGGAAAGGCTTCCTGAAGAGATCAGTGGATTGAAGTCACTCACAGATCTTTTAGTGTCACATAATTCCATTGAGGTTTTACCTGATGGCATTGGGAAGTTAAAAAATCTGTCTATCCTTAAAGTTGATCAGAATCGTCTAATGCAGTTAACCGATTGCATAGGAGAATGTGAAAGCCTTACAGAACTAATCCTTACAGAAAACCAACTCTTGGTATTACCAAGAAGCATTGGGAAATTAAAGAAGCTCTGCAATTTAAACATAGATAGGAATAAATTAATGTCTTTGCCAAAAGAGATTGGTGGTTGCTGCGGTCTTAATGTATTTTGTGTGCGTGAAAACAGATTGTCTAGGATTCCCTCTGAAATTGCAAAGGCTACTGAACTGCATGTCTTGGATGTTGCTGGAAACAGATTGACTCATTTACCATTATCACTGACCTCACTGAAGTTAAAGGCGTTATGGTTGTCTGACAACCAGTCTAAGCCTCTGCTCACTTTTCAAACTGATATAGAGCCTGAGAGTGGTGAGAAAATCTTGACGTGCGTACTATTTCCACAGATGCCTTCTGAGCCCAGTGGCCAAGACAATTTACCAAGATGCGGGGCTTTTGAAAGTTTGGTAAATGACATGTCAGATGAAACCTGGAATGAAAAAGCCATGAACAGAATAAGTGCCATACGATTTTTAGATGACACGAAGGAAGAAGATGATGATGAATCGGCAACTCTGTTGAGAAGGGCCACTCCTCACCCCGGGGAACTTAAAAACATGAAAAAGACTGTGGAGAACATACGTTCGAACCTGAATGCTGCTAAAGGACTGGATTCTAACAAAAACGAGGTCAATAATGCCACTGACAGAGTGACCACGTCTGTGTAG
Full Trace Sequence: ctgtgagggtggccagtaacctgctttgagtgagtggcggggtgcgtgtgaatcactgtacagccagactagggggtgttgtgacccccctcccaggaggggcgggcagtctgagcagttgtgagtgcagtgtgtgtggtgtgacctggggagcccaacaacttggttctgagtgtgaggtcgggccggcggattgagtagctcgcagctggggcgggctgaccacaaggcacgggggggtgccagctgttcggactttccccggggatgtttcattgcatccccctgtggcggtgtaaccgtcatgtggagtccgtggataagagacactgctccctgctcgcagtcccggaggagatttatagatacagccggagtctggaggagctgctcctggacgccaaccaactgcgggaactccccaagcaatttttccaacttgttaagttaagaaaattgggccttagcgacaatgaaatacaacggcttcctccagagatagcaaactttatgcaattggtagagctggatgtgtctcgaaatgaaattcctgaaattcctgaaagcatctcattttgcaaagcactccaagtagctgattttagtggaaatccacttaccaggttgcctgatagtttccctgaccttgcaagccttacttgtctttccattaatgacatctcacttcaggtgctcccagaaaatattggaaatttatccaacctggtatctctcgagctaagagaaaatttgttaacgtttttaccagaatctcttgcgcaactgcatagattagaagagcttgatataggaaacaatgaactttataatttgccagagaccattggatcactatataaacttaaggacctttggctagatggaaatcagcttgcagatttacctccggaaataggacatctaaaaaatcttctttgtttggatttgtctgaaaacaaactggaaaggcttcctgaagagatcagtggattgaagtcactcacagatcttttagtgtcacataattccattgaggttttacctgatggcattgggaagttaaaaaatctgtctatccttaaagttgatcagaatcgtctaatgcagttaaccgattgcataggagaatgtgaaagccttacagaactaatccttacagaaaaccaactcttggtattaccaagaagcattgggaaattaaagaagctctgcaatttaaacatagataggaataaattaatgtctttgccaaaagagattggtggttgctgcggtcttaatgtattttgtgtgcgtgaaaacagattgtctaggattccctctgaaattgcaaaggctactgaactgcatgtcttggatgttgctggaaacagattgactcatttaccattatcactgacctcactgaagttaaaggcgttatggttgtctgacaaccagtctaagcctctgctcacttttcaaactgatatagagcctgagagtggtgagaaaatcttgacgtgcgtactatttccacagatgccttctgagcccagtggccaagacaatttaccaagatgcggggcttttgaaagtttggtaaatgacatgtcagatgaaacctggaatgaaaaagccatgaacagaataagtgccatacgatttttagatgacacgaaggaagaagatgatgatgaatcggcaactctgttgagaagggccactcctcaccccggggaacttaaaaacatgaaaaagactgtggagaacatacgttcgaacctgaatgctgctaaaggactggattctaacaaaaacgaggtcaataatgccactgacagagtgaccacgtctgtgtagagttccacttccacatcttacctcctgtgtcttccctgctgtcgaaatgtccctctgcttccaggatcacattctctcctttgtttgtaccagaacatgattcatctcccttcctttgtaaccttgttgaggtgctgcttactggacagaagtgccttatatcagtcagttgcttgcacctgtgatctctaaattaatgctgtaattttgtattttacgaattgtgttttaataagtggtacacactactgcatattttttaattcttttacttggggaatatattgtgtattttttaactgctgggatattttattaccagttattttttttcaacacactggtgaaaattatatagttttatgtgaaaattataatttttttactttttggcagcttaactggtgtacaatataaatataattgtataggagcttgaaaatgtggtttggtgtgttttaatagagagcataaaggatggtacatatgtcaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MFHCIPLWRCNRHVESVDKRHCSLLAVPEEIYRYSRSLEELLLDANQLRELPKQFFQLVKLRKLGLSDNEIQRLPPEIANFMQLVELDVSRNEIPEIPESISFCKALQVADFSGNPLTRLPDSFPDLASLTCLSINDISLQVLPENIGNLSNLVSLELRENLLTFLPESLAQLHRLEELDIGNNELYNLPETIGSLYKLKDLWLDGNQLADLPPEIGHLKNLLCLDLSENKLERLPEEISGLKSLTDLLVSHNSIEVLPDGIGKLKNLSILKVDQNRLMQLTDCIGECESLTELILTENQLLVLPRSIGKLKKLCNLNIDRNKLMSLPKEIGGCCGLNVFCVRENRLSRIPSEIAKATELHVLDVAGNRLTHLPLSLTSLKLKALWLSDNQSKPLLTFQTDIEPESGEKILTCVLFPQMPSEPSGQDNLPRCGAFESLVNDMSDETWNEKAMNRISAIRFLDDTKEEDDDESATLLRRATPHPGELKNMKKTVENIRSNLNAAKGLDSNKNEVNNATDRVTTSV
Donor tissue: tailbud