ORFeome > MGC75689 – XORFeome 2.0

MGC75689 – XORFeome 2.0

General Information

Species: Xenopus tropicalis hypothetical protein MGC75689, mRNA (cDNA clone MGC:75689 IMAGE:5380317), complete cds
Gene Symbol: MGC75689
Gene ID: 394674
ORF gb_acc: MG132885
ORF ID: 10248

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC061261

Library Location

Plate ID: GDExt11003
Well Location: F05

EST Sequences

Clone: MGC:75689 IMAGE:5380317
Trimmed Sequence: ATGGCCAACTCCGGGCTGCAGCTGCTGGGCTTCGTACTGGCGCTGCTGGGATGGATCGCACTAATCGCAGCGACTATTATGCCGCAGTGGAAGATGTCCTCCTATGCCGGGGACCAGATCATCACGGCGGTGGCGATTTACCAAGGGCTGTGGATGTCTTGCGCCACCCAGAGTACGGGGCAGATTCAGTGCAAAGTCTATGACTCCCTACTGCAGCTGGACGCATCTCTGCAGGCCACGCGGGCACTCATGGTGGTCTCCATCATCCTGGGGGTATTTGGCCTCGCCATATCTACCATGGGCATGAAATGCACCAACTGTGGGGGGGATGACAAAGTGAAGAAGTCTCGCATTGCAATGACTGGCGGATTTGTCTTTCTGATTGGGGGTCTGGCAGCGCTCATTGCCTGCTCCTGGTATGGGAACCAGATCATTCGGGATTTTATTGATGAAGTTTGTAAAGGGCATTGGGGGGGATTTTAA
Full Trace Sequence: gcggaggaaggagacggatcggattctatcggccggggataaactactcgatcgttcggagcccccccccccccccccagcagcagcgaggagtaggggcccctgtgtgtccctgagcttgtacttaccccccctagtgcaggggcaaaggactcctacctacccccacactccaaccccccagggatggccaactccgggctgcagctgctgggcttcgtactggcgctgctgggatggatcgcactaatcgcagcgactattatgccgcagtggaagatgtcctcctatgccggggaccagatcatcacggcggtggcgatttaccaagggctgtggatgtcttgcgccacccagagtacggggcagattcagtgcaaagtctatgactccctactgcagctggacgcatctctgcaggccacgcgggcactcatggtggtctccatcatcctgggggtatttggcctcgccatatctaccatgggcatgaaatgcaccaactgtgggggggatgacaaagtgaagaagtctcgcattgcaatgactggcggatttgtctttctgattgggggtctggcagcgctcattgcctgctcctggtatgggaaccagatcattcgggattttattgatgaagtttgtaaagggcattgggggggattttaacactgataccctaatcccagatcagcagtaagtgcaagtgggcctgagcctggggtgtaggggccccccattatgtatctagatttatacgctttgtgacttgtagcagattttcttgtttttgtaaataaaacttttttttcaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MANSGLQLLGFVLALLGWIALIAATIMPQWKMSSYAGDQIITAVAIYQGLWMSCATQSTGQIQCKVYDSLLQLDASLQATRALMVVSIILGVFGLAISTMGMKCTNCGGDDKVKKSRIAMTGGFVFLIGGLAALIACSWYGNQIIRDFIDEVCKGHWGGF
Donor tissue: tadpole