ORFeome > MGC75691 – XORFeome 2.0

MGC75691 – XORFeome 2.0

General Information

Species: Xenopus tropicalis hypothetical protein MGC75691, mRNA (cDNA clone MGC:75691 IMAGE:5380341), complete cds
Gene Symbol: MGC75691
Gene ID: 394471
ORF gb_acc: MG132896
ORF ID: 10260

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC059737

Library Location

Plate ID: GDExt11003
Well Location: G05

EST Sequences

Clone: MGC:75691 IMAGE:5380341
Trimmed Sequence: ATGGCAACCCCCTCAAACCTAGTAGCTAACCGTGGCAGGCGCTTCAAGTGGGCCATTGAATTTGGAAGTGGTGGAAGCAGGGGTCGTGGTGAAAGAGGGGGATTGCAAGACAGCATGTATCCTGTAGGCTATTCAGACAAACAGGTTCCAGACACTAGTGTGCAAGAGTCTGACCACATCCTGGTGGAAAAGCGATGCTGGGACATTGCTTTGGGGCCACTTAAACAGATTCCCATGAACCTGTTTATCATGTACATGGCAGGAAATACAATCTCCATTTTTCCTATCATGATGGTTTGTATGATGGCATGGAGGCCAATCCAGGCACTACTTGCAACACCAGCCACTTTTAAGCTTTTGGAAAGTTCTGGTCAGCGTTTCCTCCAGGGTTTGGTGTATCTGATTGGGAACCTCTTAGGTTTGGCATTAGCTGTCTACAAGTGTCAATCAATGGGCCTTTTGCCAACACATGCATCTGATTGGTTAGCCTTTATTGAACCACCAGAGAGAATGGAGTATACAGGAGGAGGACTCCTACTGTGA
Full Trace Sequence: ggactggagtcgaggaagtgaacggtaatggtgttgcgggacaattaaatagctatccgggactgttgggcgggtgcagcaatggcaaccccctcaaacctagtagctaaccgtggcaggcgcttcaagtgggccattgaatttggaagtggtggaagcaggggtcgtggtgaaagagggggattgcaagacagcatgtatcctgtaggctattcagacaaacaggttccagacactagtgtgcaagagtctgaccacatcctggtggaaaagcgatgctgggacattgctttggggccacttaaacagattcccatgaacctgtttatcatgtacatggcaggaaatacaatctccatttttcctatcatgatggtttgtatgatggcatggaggccaatccaggcactacttgcaacaccagccacttttaagcttttggaaagttctggtcagcgtttcctccagggtttggtgtatctgattgggaacctcttaggtttggcattagctgtctacaagtgtcaatcaatgggccttttgccaacacatgcatctgattggttagcctttattgaaccaccagagagaatggagtatacaggaggaggactcctactgtgatggagtgaaacgtacaacaagttgaaacaaaataaccctactgctgtaaatcccactgttgtctattaataaattattatacctccaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MATPSNLVANRGRRFKWAIEFGSGGSRGRGERGGLQDSMYPVGYSDKQVPDTSVQESDHILVEKRCWDIALGPLKQIPMNLFIMYMAGNTISIFPIMMVCMMAWRPIQALLATPATFKLLESSGQRFLQGLVYLIGNLLGLALAVYKCQSMGLLPTHASDWLAFIEPPERMEYTGGGLLL
Donor tissue: tadpole