ORFeome > MGC75700 – XORFeome 2.0

MGC75700 – XORFeome 2.0

General Information

Species: Xenopus tropicalis adenine nucleotide translocase, mRNA (cDNA clone MGC:75700 IMAGE:5380565), complete cds
Gene Symbol: MGC75700
Gene ID: 394508
ORF gb_acc: MG132975
ORF ID: 10353

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC059739

Library Location

Plate ID: GDExt11004
Well Location: C02

EST Sequences

Clone: MGC:75700 IMAGE:5380565
Trimmed Sequence: ATGACTGACGCAGCCATCTCTTTTGCCAAGGACTTCTTGGCCGGCGGTGTGGCCGCAGCTATCTCCAAGACCGCTGTAGCACCTATTGAAAGAGTCAAGCTTCTACTGCAAGTCCAACATGCAAGCAAACAGATCACCGCAGACAAGCACTACAAGGGCATCATGGACTGTGTTGTCAGAATCCCCAAAGAACAGGGTTTCATGTCTTTTTGGCGTGGTAACCTTGCCAACGTGATCCGTTATTTCCCAACCCAGGCCCTCAACTTCGCCTTCAAAGACAAGTACAAGAAGATCTTCCTGGACAATGTAGACAAGAAGACCCAGTTCTGGCGCTACTTTGCTGGCAACCTTGCTTCTGGTGGTGCTGCTGGGGCAACCTCCCTCTGCTTTGTCTACCCCCTTGACTTTGCCCGTACCCGTCTAGCAGCTGATGTGGGCAAAGGCAATGCTGAGAGAGAGTTCAAGGGCCTTGGTGATTGCTTAGTTAAGATCTCCAGATCTGATGGGATCAAGGGCTTGTACCAGGGATTCAACGTATCTGTTCAGGGCATCATCATCTACAGAGCTGCTTATTTTGGCATCTATGATACAGCTAAAGGTATGCTTCCAGATCCCAAGAACACACACATTATCATCAGCTGGATGATTGCTCAGACTGTAACAGCGGTAGCTGGATTTGTCTCCTATCCATTTGACACAGTACGTCGTCGTATGATGATGCAGTCTGGAAGGAAAGGAGCTGACATCATGTACAGTGGAACAATTGACTGCTGGAGGAAGATTGCACGGGATGAGGGCAGCAGGGCTTTCTTCAAGGGTGCCTGGTCCAATGTTCTCAGAGGAATGGGTGGCGCTTTTGTGCTGGTGTTGTATGATGAGCTGAAGAAATACATCTAA
Full Trace Sequence: tgcttcttgagcctagcatctgctaacgtaacaccggcatcaccatgactgacgcagccatctcttttgccaaggacttcttggccggcggtgtggccgcagctatctccaagaccgctgtagcacctattgaaagagtcaagcttctactgcaagtccaacatgcaagcaaacagatcaccgcagacaagcactacaagggcatcatggactgtgttgtcagaatccccaaagaacagggtttcatgtctttttggcgtggtaaccttgccaacgtgatccgttatttcccaacccaggccctcaacttcgccttcaaagacaagtacaagaagatcttcctggacaatgtagacaagaagacccagttctggcgctactttgctggcaaccttgcttctggtggtgctgctggggcaacctccctctgctttgtctacccccttgactttgcccgtacccgtctagcagctgatgtgggcaaaggcaatgctgagagagagttcaagggccttggtgattgcttagttaagatctccagatctgatgggatcaagggcttgtaccagggattcaacgtatctgttcagggcatcatcatctacagagctgcttattttggcatctatgatacagctaaaggtatgcttccagatcccaagaacacacacattatcatcagctggatgattgctcagactgtaacagcggtagctggatttgtctcctatccatttgacacagtacgtcgtcgtatgatgatgcagtctggaaggaaaggagctgacatcatgtacagtggaacaattgactgctggaggaagattgcacgggatgagggcagcagggctttcttcaagggtgcctggtccaatgttctcagaggaatgggtggcgcttttgtgctggtgttgtatgatgagctgaagaaatacatctaaacttgtcctcgttgagatgtctgtgacctggcatgctgtattatgtaacataccttgaacattcatggaccttctttatttttttttgtcaaacacacccttatttataaaatatagctggtaatctttactggctggtattttgggatcagttctattacatctcaccagctttccacattaataaatcattccctttaagtctcttactgcttttagtgcctgcaactgtgcctccttggcagtttttggccctttggcagtgacaggctgattcagtgggactcaacgctcctttattttttatttcagtcattcatgtttttaagtaacttaggtttgaggaaataaaaaatacggatctaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MTDAAISFAKDFLAGGVAAAISKTAVAPIERVKLLLQVQHASKQITADKHYKGIMDCVVRIPKEQGFMSFWRGNLANVIRYFPTQALNFAFKDKYKKIFLDNVDKKTQFWRYFAGNLASGGAAGATSLCFVYPLDFARTRLAADVGKGNAEREFKGLGDCLVKISRSDGIKGLYQGFNVSVQGIIIYRAAYFGIYDTAKGMLPDPKNTHIIISWMIAQTVTAVAGFVSYPFDTVRRRMMMQSGRKGADIMYSGTIDCWRKIARDEGSRAFFKGAWSNVLRGMGGAFVLVLYDELKKYI
Donor tissue: tadpole