ORFeome > MGC75708 – XORFeome 2.0

MGC75708 – XORFeome 2.0

General Information

Species: Xenopus tropicalis Fructose-1,6-bisphosphatase, mRNA (cDNA clone MGC:75708 IMAGE:5380710), complete cds
Gene Symbol: MGC75708
Gene ID: 394750
ORF gb_acc: MG132960
ORF ID: 10336

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC061270

Library Location

Plate ID: GDExt11003
Well Location: E09

EST Sequences

Clone: MGC:75708 IMAGE:5380710
Trimmed Sequence: ATGACGGACCAGGCCCCCTTCAACACCGATGTGATTACCCTGACTCGCTTCGTTATGGAGGAGGGCAGGAAAGCCAAGGGGACCGGAGAATTAACTCAACTCCTTAACTCGATGTGCACGGCTATAAAAGCAATCTCTTCCGCAGTGCGCAAAGCTGGCCTGGCCAACCTCTATGGTATTGCCGGATCCACTAATGTGACAGGGGACCAAGTGAAAAAACTAGATGTCCTCTCCAATGACCTTGTTATCAACATGCTCAAGTCCTCATACAGTGCCTGTGTCCTAGTGTCAGAAGAAGACCAGCATGCTCTGATTGTGGAGCCTGAAAAACGGGGTAAATACGTGGTGTGCTTTGATCCTTTGGATGGCTCTTCGAACATTGACTGCCTGGCTTCTATTGGTACAATATTTTCCATCTACAAAAAGACTACAGAAGGAGAGCCAACTGAAAAAGATGCTCTACAACCAGGACGAAACATTGTTGCTGCAGGCTATGCCCTATATGGCAGTGCAACAATGTTGGTTCTTGCCACAGAATGTGGTGTCAACTGTTTCATGTTGGACCCAGCAATTGGAGAGTTCATTTTAGTAAACCAGGATGTGAAAATCAAAAAGAAGGGCAACATTTACAGCCTGAATGAGGGTTATGCCAAGTATTCTGATGAAGCAGTTACTGAATACTTACAGAAAAAGAAATTTCCAGAAGATGGGAGCTCACCCTACGGTGCAAGGTATGTTGGTTCAATGGTAGCTGATGTGCATCGTACATTGGTTTATGGAGGAATCTTTCTATACCCAGCCAATGTAAAGAGCCCAAAGGGCAAGCTGAGGCTTCTGTATGAGTGCAACCCAATGGCTTTCATTATGGAGAAGGCCGGAGGAATGGCTACTAATGGACTTGAGTCAGTTCTTGATGTAGTACCTGAGAGTATCCACCAGAGGATGCCAGTAGCTTTGGGCTCCCCAGATGATGTGCAGGAATATATTAACATTTACAAGAAATATGCAAAGAAATAA
Full Trace Sequence: ctagcagtgtacttacctgtccagagccactaacagcaccaccatgacggaccaggcccccttcaacaccgatgtgattaccctgactcgcttcgttatggaggagggcaggaaagccaaggggaccggagaattaactcaactccttaactcgatgtgcacggctataaaagcaatctcttccgcagtgcgcaaagctggcctggccaacctctatggtattgccggatccactaatgtgacaggggaccaagtgaaaaaactagatgtcctctccaatgaccttgttatcaacatgctcaagtcctcatacagtgcctgtgtcctagtgtcagaagaagaccagcatgctctgattgtggagcctgaaaaacggggtaaatacgtggtgtgctttgatcctttggatggctcttcgaacattgactgcctggcttctattggtacaatattttccatctacaaaaagactacagaaggagagccaactgaaaaagatgctctacaaccaggacgaaacattgttgctgcaggctatgccctatatggcagtgcaacaatgttggttcttgccacagaatgtggtgtcaactgtttcatgttggacccagcaattggagagttcattttagtaaaccaggatgtgaaaatcaaaaagaagggcaacatttacagcctgaatgagggttatgccaagtattctgatgaagcagttactgaatacttacagaaaaagaaatttccagaagatgggagctcaccctacggtgcaaggtatgttggttcaatggtagctgatgtgcatcgtacattggtttatggaggaatctttctatacccagccaatgtaaagagcccaaagggcaagctgaggcttctgtatgagtgcaacccaatggctttcattatggagaaggccggaggaatggctactaatggacttgagtcagttcttgatgtagtacctgagagtatccaccagaggatgccagtagctttgggctccccagatgatgtgcaggaatatattaacatttacaagaaatatgcaaagaaataaaggacagctgaatggatttcatatcaagaaggaccaaagaataaaccagcagcttctttttaatgtgccaaaacataaagaaatatgtttacttttgtacacaataacaaatagatttttatattattgaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MTDQAPFNTDVITLTRFVMEEGRKAKGTGELTQLLNSMCTAIKAISSAVRKAGLANLYGIAGSTNVTGDQVKKLDVLSNDLVINMLKSSYSACVLVSEEDQHALIVEPEKRGKYVVCFDPLDGSSNIDCLASIGTIFSIYKKTTEGEPTEKDALQPGRNIVAAGYALYGSATMLVLATECGVNCFMLDPAIGEFILVNQDVKIKKKGNIYSLNEGYAKYSDEAVTEYLQKKKFPEDGSSPYGARYVGSMVADVHRTLVYGGIFLYPANVKSPKGKLRLLYECNPMAFIMEKAGGMATNGLESVLDVVPESIHQRMPVALGSPDDVQEYINIYKKYAKK
Donor tissue: tadpole