ORFeome > MGC75758 – XORFeome 2.0

MGC75758 – XORFeome 2.0

General Information

Species: Xenopus tropicalis similar to breast carcinoma amplified sequence 2, mRNA (cDNA clone MGC:75758 IMAGE:5381609), complete cds
Gene Symbol: MGC75758
Gene ID: 394520
ORF gb_acc: MG132920
ORF ID: 10286

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC059752

Library Location

Plate ID: GDExt11003
Well Location: A07

EST Sequences

Clone: MGC:75758 IMAGE:5381609
Trimmed Sequence: ATGGCGGGGACCAGTCTGGTTGCCGGGGATGTTGTGGTGGATGCGCTGCCCTATTTCGATCAGGGCTATGATGCGCAGGGAGTGCGGGAAGCGGCTGCAGCTTTGGTGGAAGAGGAGACCAGAAGATATCGGCCTACAAAGAACTACCTGAGTTACTTGCCCACCCCCGACTATTCAGCATTTGAGACTGAAATCATGAGGAACGAGTTTGAAAGACTTTCGTCGCGCCAGCCCCTCGAACTGCTCAGCATGAAGAGGTATGAGTTACCGGCCCCCCTATCCGGCCAGAGGAACGACATCACCGCGTGGCAGGAATGTGTCAATAACTCCATGGCCCAATTGGAACACCAGGCCGTCCGTATAGAGAACCTGGAGCTCATGTCCCAGCACGGCTGTAACGCCTGGAAAGTCTATAACGAGAACCTGCTGCATATGATCGACTGCGCGCAGAAAGATCTCCAGAAGTTACGGAAAAAGATTCAGGACTTGAACTGGCAGAGAAAGAACTCCCAGCTGACAGCAGGTGCCCGACTCAGAGAGATGGAGTCAACGTGGGTGTCTCTTGTGAGCAAAAACTACGAGATTGAGAGAGCAATTGTGCAAATGGAGAATGAAGTCTATCAGCTGAAAGAGAGGAGCGGGGAGAATAAGGAAAATATTGAAGATTATTAA
Full Trace Sequence: ccggagcgcaaagatggcggggaccagtctggttgccggggatgttgtggtggatgcgctgccctatttcgatcagggctatgatgcgcagggagtgcgggaagcggctgcagctttggtggaagaggagaccagaagatatcggcctacaaagaactacctgagttacttgcccacccccgactattcagcatttgagactgaaatcatgaggaacgagtttgaaagactttcgtcgcgccagcccctcgaactgctcagcatgaagaggtatgagttaccggcccccctatccggccagaggaacgacatcaccgcgtggcaggaatgtgtcaataactccatggcccaattggaacaccaggccgtccgtatagagaacctggagctcatgtcccagcacggctgtaacgcctggaaagtctataacgagaacctgctgcatatgatcgactgcgcgcagaaagatctccagaagttacggaaaaagattcaggacttgaactggcagagaaagaactcccagctgacagcaggtgcccgactcagagagatggagtcaacgtgggtgtctcttgtgagcaaaaactacgagattgagagagcaattgtgcaaatggagaatgaagtctatcagctgaaagagaggagcggggagaataaggaaaatattgaagattattaaggccccacccaaaggattacaggttccagggtaacagcaccggtcctgctgcagagactctggcgccatgttgggcagcgctgctgggggttctggttgctttatggctcttcactctggaaatgtagcgagtagtctctgcctgggtgctgataggcgcagggatgggtttccctgtttcacccaaatgccccagtgctggctcgtaggccgggcacataccggcttttataaggaaattctgacttgtttttcactgtaatattaataataaagtgttttccagaaaaaaaccaaaaaaaaaaaaaaaa
Translation: MAGTSLVAGDVVVDALPYFDQGYDAQGVREAAAALVEEETRRYRPTKNYLSYLPTPDYSAFETEIMRNEFERLSSRQPLELLSMKRYELPAPLSGQRNDITAWQECVNNSMAQLEHQAVRIENLELMSQHGCNAWKVYNENLLHMIDCAQKDLQKLRKKIQDLNWQRKNSQLTAGARLREMESTWVSLVSKNYEIERAIVQMENEVYQLKERSGENKENIEDY
Donor tissue: tadpole