ORFeome > MGC75767 – XORFeome 2.0

MGC75767 – XORFeome 2.0

General Information

Species: Xenopus tropicalis tubulin, alpha 1, mRNA (cDNA clone MGC:75767 IMAGE:5381815), complete cds
Gene Symbol: MGC75767
Gene ID: 394734
ORF gb_acc: MG132905
ORF ID: 10270

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC061297

Library Location

Plate ID: GDExt11004
Well Location: D02

EST Sequences

Clone: MGC:75767 IMAGE:5381815
Trimmed Sequence: ATGAGGGAGTGCATCTCAGTCCATGTGGGGCAGGCAGGAGTGCAGATTGGCAATGCATGCTGGGAGCTGTACTGCCTGGAACATGGGATCCAACCGGACGGCCAGATGCCCAGCGACAAAACCATTGGGGGAGGGGACGATTCCTTCAACACCTTCTTCAGTGAGACCGGAGCCGGGAAGCACGTCCCCCGCGCTGTGTTTGTGGACCTGGAGCCCACTGTGATTGATGAGGTTCGGACCGGTACCTACCGGCAGCTTTTCCACCCTGAGCAACTCATCACAGGCAAGGAAGATGCCGCCAATAACTACGCCCGCGGCCATTACACCATCGGCAAGGAGATCATTGACCTGGTGCTGGACAGGATCCGCAAGCTGGCGGATCAGTGCACAGGACTCCAGGGCTTCCTCATCTTCCACAGCTTCGGGGGGGGCACTGGCTCTGGATTCACCTCCTTGCTGATGGAACGTCTCTCTGTTGACTATGGCAAGAAGTCCAAGCTGGAATTCTCCATCTATCCAGCTCCTCAAATCTCCACGGCTGTGGTGGAACCCTACAACTCCATCCTCACCACCCACACAACACTGGAGCACTCAGACTGTGCCTTCATGGTGGATAATGAAGCCATTTATGACATCTGCAGAAGGAACCTGGACATTGAACGCCCAACCTACACCAACCTGAACCGTCTGATTGGCCAGATTGTGTCCTCTATCACTGCCTCCCTCAGATTTGATGGAGCCCTGAATGTGGACCTGACAGAATTCCAAACCAACTTGGTACCCTACCCCCGTATCCATTTCCCCCTGGCCACCTATGCCCCTGTTATCTCTGCAGAGAAAGCTTACCATGAGCAGCTCTCTGTATCCGAGATCACCAATGCTTGCTTTGAGCCAGCCAATCAGATGGTGAAATGTGACCCCCGTCATGGTAAATACATGGCTTGTTGCCTGCTGTACCGCGGTGATGTGGTGCCCAAAGATGTCAATGCTGCTATTGCCACAGTGAAAACCAAGCGCACCATCCAGTTTGTGGACTGGTGCCCAACTGGTTTCAAGGTTGGTATCAACTACCAGCCCCCAACTGTGGTTCCGGGTGGGGATCTGGCCAAGGTACAGCGAGCTGTGTGCATGTTGAGCAACACCACCGCCATTGCTGAGGCCTGGGCTCGCCTGGATCACAAGTTTGACCTTATGTATGCCAAGCGTGCCTTTGTGCACTGGTATGTAGGGGAGGGAATGGAGGAAGGGGAGTTCTCTGAGGCCCGCGAGGATATGGCCGCCCTGGAGAAGGATTATGAGGAGGTCGGAACTGACAGCGTGGAGGGAGAGGGAGAAGAAGAGGGAGAAGAATACTAA
Full Trace Sequence: cgagcacataacttatcggaaccaggagtctatcagccaacaacatgagggagtgcatctcagtccatgtggggcaggcaggagtgcagattggcaatgcatgctgggagctgtactgcctggaacatgggatccaaccggacggccagatgcccagcgacaaaaccattgggggaggggacgattccttcaacaccttcttcagtgagaccggagccgggaagcacgtcccccgcgctgtgtttgtggacctggagcccactgtgattgatgaggttcggaccggtacctaccggcagcttttccaccctgagcaactcatcacaggcaaggaagatgccgccaataactacgcccgcggccattacaccatcggcaaggagatcattgacctggtgctggacaggatccgcaagctggcggatcagtgcacaggactccagggcttcctcatcttccacagcttcggggggggcactggctctggattcacctccttgctgatggaacgtctctctgttgactatggcaagaagtccaagctggaattctccatctatccagctcctcaaatctccacggctgtggtggaaccctacaactccatcctcaccacccacacaacactggagcactcagactgtgccttcatggtggataatgaagccatttatgacatctgcagaaggaacctggacattgaacgcccaacctacaccaacctgaaccgtctgattggccagattgtgtcctctatcactgcctccctcagatttgatggagccctgaatgtggacctgacagaattccaaaccaacttggtaccctacccccgtatccatttccccctggccacctatgcccctgttatctctgcagagaaagcttaccatgagcagctctctgtatccgagatcaccaatgcttgctttgagccagccaatcagatggtgaaatgtgacccccgtcatggtaaatacatggcttgttgcctgctgtaccgcggtgatgtggtgcccaaagatgtcaatgctgctattgccacagtgaaaaccaagcgcaccatccagtttgtggactggtgcccaactggtttcaaggttggtatcaactaccagcccccaactgtggttccgggtggggatctggccaaggtacagcgagctgtgtgcatgttgagcaacaccaccgccattgctgaggcctgggctcgcctggatcacaagtttgaccttatgtatgccaagcgtgcctttgtgcactggtatgtaggggagggaatggaggaaggggagttctctgaggcccgcgaggatatggccgccctggagaaggattatgaggaggtcggaactgacagcgtggagggagagggagaagaagagggagaagaatactaaaactatgcctaaagtaattcacacattactatgtcagcttaacattgcatatatacatataagtaaattattgagataaaacctttaagaaaaataaaagaactggcaacatcaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MRECISVHVGQAGVQIGNACWELYCLEHGIQPDGQMPSDKTIGGGDDSFNTFFSETGAGKHVPRAVFVDLEPTVIDEVRTGTYRQLFHPEQLITGKEDAANNYARGHYTIGKEIIDLVLDRIRKLADQCTGLQGFLIFHSFGGGTGSGFTSLLMERLSVDYGKKSKLEFSIYPAPQISTAVVEPYNSILTTHTTLEHSDCAFMVDNEAIYDICRRNLDIERPTYTNLNRLIGQIVSSITASLRFDGALNVDLTEFQTNLVPYPRIHFPLATYAPVISAEKAYHEQLSVSEITNACFEPANQMVKCDPRHGKYMACCLLYRGDVVPKDVNAAIATVKTKRTIQFVDWCPTGFKVGINYQPPTVVPGGDLAKVQRAVCMLSNTTAIAEAWARLDHKFDLMYAKRAFVHWYVGEGMEEGEFSEAREDMAALEKDYEEVGTDSVEGEGEEEGEEY
Donor tissue: tadpole