ORFeome > MGC75786 – XORFeome 2.0

MGC75786 – XORFeome 2.0

General Information

Species: Xenopus tropicalis hypothetical protein MGC75786, mRNA (cDNA clone MGC:75786 IMAGE:5382042), complete cds
Gene Symbol: MGC75786
Gene ID: 394819
ORF gb_acc: MG132940
ORF ID: 10310

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC063339

Library Location

Plate ID: GDExt11003
Well Location: C07

EST Sequences

Clone: MGC:75786 IMAGE:5382042
Trimmed Sequence: ATGAAGCTAAAGCAGCGGGTCGCTGTCTTGGCTCTGCTGCTGGTGATTTTGGTTCTCACCAAGCTTCTTTTATTGGACCGCCTGGAGACCTCTGCTGCTCAGAGGCAGGACCAGCTGTCTTTTGAGCGTATGATGTCCGGCTTACGGCTCACCATGGACTCCCGTTTGGAGCATACCCTGCAGTCCCCTTGGGAGATTGCATCCCAATGGGTCGTGCCACGGGAAGTGTATCCTGAGGATAGCCCAGAAATGGGAGCAGTATTGCATTCTATGGCAACCAAGAAAATTGTGAAAGCTGATGTTGGCTACAAAGGCACACAGCTTAAAGCTTTGCTTGTCCTGGAAGGTGGACAAAAGGTGGTATTTAAGCCCAAAAGATACAGCCGTGATTATATTGTGGAAGGAGAACCGTACGCTGGGTATGACAGGCATAATGCTGAAGTCACTGCTTTTCATTTAGACAGAATTCTGGGTTTCAGACGAGCTCCTTTAGTTGTTGGGCGATATGTGAATCTAATCACTGAGATTAAACCTGTAGCTACTGAGCAGCTTCTGAGCACCTTTCTAAAGCAGGGTAACAATACCTGTTTCTATGGGAAGTGCTACTACTGCCGGGAGACAGAGCCCGCCTGTGCAGAACGAGAACTGATGGAAGGTACAGTTACACTATGGCTCCCTGAAGCATGGCCCCTTCAGAAGCATCGACACCCTTGGGGAAGGACCTACCGTGAGGGAAAGTTGGCAAGGTGGGAATATGATGAAAGTTACTGTGATGCTGTGAAGAAGACCTCACCTTATGACTCTGGACCAAGACTCCTGGATGTTATTGATACAGCTATTTTTGATTTCTTGATTGGAAATGCAGACCGTCATCATTATGAGAGTTTTCAAGATGACGAGGGTGGCAGCATGCTAATACTACTGGACAATGCTAAGAGTTTCGGGAATCCATTAGTAGATGAGCGAAGTATTTTGGCTCCCCTGTACCAGTGCTGCATTATTCGTGTTTCCACGTGGAACCGTCTTTCTCACTTGAAGCATGGCACTTTACGCTCTGCTTTATTGACTGCTACTGCTCATGACCCAATCTCTCCGGTGCTGTCAGATGCTCACCTCGATGCTTTAGAGCGCCGACTACAAAGCATATTGGCAACGGTTCAGCAATGCATAGGACAGTTTGGAGCTGATGTTGTCATGGTGGAGGACAGGATGACTTTTACCCATATGTAA
Full Trace Sequence: ggtagagtgtgtgatgttggcaactggggatcagcaaccgtgtgttggaggttcctgcaggaatcaaacagcgcaatgccctgcacctggcacacataggacatcacccttctttgctaagagctttttatcttgggcatcatgaagctaaagcagcgggtcgctgtcttggctctgctgctggtgattttggttctcaccaagcttcttttattggaccgcctggagacctctgctgctcagaggcaggaccagctgtcttttgagcgtatgatgtccggcttacggctcaccatggactcccgtttggagcataccctgcagtccccttgggagattgcatcccaatgggtcgtgccacgggaagtgtatcctgaggatagcccagaaatgggagcagtattgcattctatggcaaccaagaaaattgtgaaagctgatgttggctacaaaggcacacagcttaaagctttgcttgtcctggaaggtggacaaaaggtggtatttaagcccaaaagatacagccgtgattatattgtggaaggagaaccgtacgctgggtatgacaggcataatgctgaagtcactgcttttcatttagacagaattctgggtttcagacgagctcctttagttgttgggcgatatgtgaatctaatcactgagattaaacctgtagctactgagcagcttctgagcacctttctaaagcagggtaacaatacctgtttctatgggaagtgctactactgccgggagacagagcccgcctgtgcagaacgagaactgatggaaggtacagttacactatggctccctgaagcatggccccttcagaagcatcgacacccttggggaaggacctaccgtgagggaaagttggcaaggtgggaatatgatgaaagttactgtgatgctgtgaagaagacctcaccttatgactctggaccaagactcctggatgttattgatacagctatttttgatttcttgattggaaatgcagaccgtcatcattatgagagttttcaagatgacgagggtggcagcatgctaatactactggacaatgctaagagtttcgggaatccattagtagatgagcgaagtattttggctcccctgtaccagtgctgcattattcgtgtttccacgtggaaccgtctttctcacttgaagcatggcactttacgctctgctttattgactgctactgctcatgacccaatctctccggtgctgtcagatgctcacctcgatgctttagagcgccgactacaaagcatattggcaacggttcagcaatgcataggacagtttggagctgatgttgtcatggtggaggacaggatgacttttacccatatgtaactccattgcggtcccaaagacacagaaggaaactttcctatgcagttgggtttgtttctacggtacaccttgactttggtgcttcgaattgaccctcaaagcagcacagtgcatctgcagatactaaacccactggactgcaattcatctactgcttgaacctcaatgaaccaacggtagactggtagagaagtctcttcctgccacattccagtcttcgtcatttgaccttttgccaatgatgctttacagcactacaaagggacctaatgagcccctaatggtgtgggtattaaacagttgtcaaagagaatggagaatttattttcaagtcataatttattcattgtttttcatttttaggggcgtcaagctcatttttaatatttgggtgtcagtttttacataatgcacatgatggctgcaaggtagccctataacctctctagctgagcagtttgggtgccctgggcacttccgtgctgtattctgttgcttcttgtaaattattagactattttaatttatggactaattcaggaaactgatcttaagggacctgtgggggcacaatatatccatttgcactggcaaatcttgatgctgttattgtctcaatatttggaactgactaaactactgactcttttgaacgtagttttgtaacatgcaaacgatacattgctcttctgctggcatattaagccacaaaatcttctttctccatatacttatatagcccttcagtgtcagagacccacagcctcgagatttcccaagggtcaccccgtatgtttttatcaatcctgggaaaggtcccccattattaagaatagggtgcgtgcacgtatatatatatatatacagggctctttcagtgccccaacctaagaaacttcggaatgaaaaggtagaaaagggcatttgccagagagaatgttttggcaacctcattagatcagtggtgccaatatttttttagccttcgtcaaaagaattcatatttgcatctaggtgccctcctggcaaaatgactggtgacatgtatggggtaatgtcaaagcagctgaaaagtaaccagtctcaactgcccctccacagatacatttattttctagaaaggagatgaagctttgggataatggtatagtgaggcaagtggatgttaggactgttaggtttgcagcctcctgctgttgaattaaagctcccagcatccactgacagaatatggagagctgcataagcaaggcaaactcatctgggtttttggctacaattatggttaagtttccttttttctttttaattaggcactggttatcttttattttacaagtaatatcaatctaaaatgtatgcagaattctggttaataatgtgtttatttataattttgttgcataaggccagtttcttttgtgtctgctttgtttatttgaaagccagttctacatttttagtattccctaaccttttctgcaaggtgccattttggtaataaaacagtgtataaggtaggaatgcatccattccagtgtatgtgatgctaatagcttcagttcaatggcttagagcaaacaacattttgcttgaaaatttctattcattctgttaggagcaagtgggtgcatgaatgctctgagcatgtctaattacaagactgtcccctgtatgtcgcgcagtattttttaggcaccaccatagcgattattatcacttacctcttcaccaaaaatgcaccgggtattgtttagtgagtgccattgcgccatcgtcttaccttccccaagtatccctttggtctgggctgtgtgcatgcacagtaaaagtaaagctaaaactaagttaccaagcagaacttttactcttctgcacatgtgcacaacccaggggggagctaagatccccagaaaggaaagaagatggcagcacagtgctcaatagaatacttggccaggctgatgtgtttcttagcagagaagcacctgcccaggctctgaggtaagtgatttgtactgaggggtgcattacaatttgccacacccttttagaggataaccttttccttgtactttaattcaccaaaagcaccaaattcaatctttctcttggtccctaatataattcctattcagcttgttttttttatcttgttttgtaactttatttccatgcactatcctgctgcttagccatagttgcacaaaaggagccagtagcagagagagggagggcactgttctttttaactgcaaatatagttttatagccaagttcagttccttaatgagtcactgatgttattatttttgcttagtacctggcccatcccatcattattcttaccagcccctggccaaaactcaatgcaggagaatgggttttttgatagggaaagcaggagggataaatatggtggaagaagagagaatatgatcaataggaaaaaataaaaatttaagaaatcaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MKLKQRVAVLALLLVILVLTKLLLLDRLETSAAQRQDQLSFERMMSGLRLTMDSRLEHTLQSPWEIASQWVVPREVYPEDSPEMGAVLHSMATKKIVKADVGYKGTQLKALLVLEGGQKVVFKPKRYSRDYIVEGEPYAGYDRHNAEVTAFHLDRILGFRRAPLVVGRYVNLITEIKPVATEQLLSTFLKQGNNTCFYGKCYYCRETEPACAERELMEGTVTLWLPEAWPLQKHRHPWGRTYREGKLARWEYDESYCDAVKKTSPYDSGPRLLDVIDTAIFDFLIGNADRHHYESFQDDEGGSMLILLDNAKSFGNPLVDERSILAPLYQCCIIRVSTWNRLSHLKHGTLRSALLTATAHDPISPVLSDAHLDALERRLQSILATVQQCIGQFGADVVMVEDRMTFTHM
Donor tissue: neurula