ORFeome > MGC75788 – XORFeome 2.0

MGC75788 – XORFeome 2.0

General Information

Species: Xenopus tropicalis hydroxyacyl-Coenzyme A dehydrogenase/3-ketoacyl-Coenzyme A thiolase/enoyl-Coenzyme A hydratase (trifunctional protein), beta subunit, mRNA (cDNA clone MGC:75788 IMAGE:5382089), complete cds
Gene Symbol: MGC75788
Gene ID: 394747
ORF gb_acc: MG132897
ORF ID: 10262

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC061310

Library Location

Plate ID: GDExt11003
Well Location: G06

EST Sequences

Clone: MGC:75788 IMAGE:5382089
Trimmed Sequence: ATGGCGTGCATGCTGAGACAGACCATCAGAAGCCTCCCCACGGCTTGTAAACTCTCTTCCAGATCCATTAGCTGCTCTTCCCATCTCCAGGCCCCAGCTGTGCAGGCCAAAACTAAGAAGACCTTGGCCAAGCCTGGAGTTAAAAATGTGGTGATTGTGGATGGAGTGCGGACTCCTTTTTTGCTCTCAGGGACCACATATGCAGATCTGATGCCTCATGACTTGGCCAGGACAGCACTGCAGGGATTGCTGCAGAGAACCAACGTTCCCCGGGAGGTGGTTGATTACATAGTGTATGGAACTGTAATCCAGGAAGTTAAAACCAGTAATGTTGCACGAGAGGCTGCTCTGGGGGCTGGTTTTTCAGATAAAACTCCAGCGCACACAGTCACGATGGCCTGCATCTCTTCCAATCAGGCAATGACTACAGGTGTTGGGCTGATTGCATCGGGTCAGTGTGATGTGGTTGTTGCTGGTGGGGTGGAGTTCATGTCTGATGTCCCTATTCGTCACAGCAGGAAGATGAGGAAGACCATGCTGAGCCTTAATAAGGCCAAAACATTGGGCCAGAGGCTTTCTGTGATATCTGGAATCCGGCCTAACTATTTTGCACCAGAGCTCCCAGCAGTGGCTGAGTTCTCCACCAGTGAGACCATGGGACATTCAGCAGACAGACTCGCCGCAGCATTTTCTGTGTCTCGGGTGGAGCAAGATGAATACGCTCTGCGCTCTCACACACTGGCCAAGAAGGCGCAGGACGCTGGGCTGTTGTCTGACGTTATCCCCTATAAAGTACCAGGCAAACAAACGGTTGATAAGGATAATGGAATCCGTCCATCCTCTATGGAGCAGATGGCGAAGCTGAAGCCTGCCTTTATTAAGCCTCATGGTTCCGTCACTGCTGCCAACTCTTCATTTCTGACGGACGGTGCCTCTGCCGTGCTGATCATGTCGGAGGAGAAAGCCCTGGCCATGGGATACAAGCCTAAGGCCTACCTTCGGGACTTTGTTTATGTGTCTCAAGATCCCAAGGATCAGCTTCTGCTCGGCCCCACATACGCTACCCCCAAAGTACTGGAAAGGGCAGGACTGACTCTCGCTGACATTGATGCCTTTGAGTTCCATGAAGCATTTGCGGGCCAGATCCTGTCTAATCTGAAAGCCATGGATTCTGACTGGTTTGCACAGAATTACATGGGGCGAAAGGCAAAGGTTGGAGCCCCTGCTCTGGACAAGTTTAACATGTGGGGGGGCTCGCTGTCGCTGGGACACCCGTTTGGAGCCACAGGTTGCCGGCTGGTCATGGCTGCTGCCCACAGGCTGAAGAAGGACGGAGGGCAATACGGCCTTGTGGCAGCGTGTGCGGCAGGGGGGCAGGGACACGGGATGATCGTGGAACTTTACCCCCAGTAA
Full Trace Sequence: gagggaaagtaaggttccacaatggcgtgcatgctgagacagaccatcagaagcctccccacggcttgtaaactctcttccagatccattagctgctcttcccatctccaggccccagctgtgcaggccaaaactaagaagaccttggccaagcctggagttaaaaatgtggtgattgtggatggagtgcggactccttttttgctctcagggaccacatatgcagatctgatgcctcatgacttggccaggacagcactgcagggattgctgcagagaaccaacgttccccgggaggtggttgattacatagtgtatggaactgtaatccaggaagttaaaaccagtaatgttgcacgagaggctgctctgggggctggtttttcagataaaactccagcgcacacagtcacgatggcctgcatctcttccaatcaggcaatgactacaggtgttgggctgattgcatcgggtcagtgtgatgtggttgttgctggtggggtggagttcatgtctgatgtccctattcgtcacagcaggaagatgaggaagaccatgctgagccttaataaggccaaaacattgggccagaggctttctgtgatatctggaatccggcctaactattttgcaccagagctcccagcagtggctgagttctccaccagtgagaccatgggacattcagcagacagactcgccgcagcattttctgtgtctcgggtggagcaagatgaatacgctctgcgctctcacacactggccaagaaggcgcaggacgctgggctgttgtctgacgttatcccctataaagtaccaggcaaacaaacggttgataaggataatggaatccgtccatcctctatggagcagatggcgaagctgaagcctgcctttattaagcctcatggttccgtcactgctgccaactcttcatttctgacggacggtgcctctgccgtgctgatcatgtcggaggagaaagccctggccatgggatacaagcctaaggcctaccttcgggactttgtttatgtgtctcaagatcccaaggatcagcttctgctcggccccacatacgctacccccaaagtactggaaagggcaggactgactctcgctgacattgatgcctttgagttccatgaagcatttgcgggccagatcctgtctaatctgaaagccatggattctgactggtttgcacagaattacatggggcgaaaggcaaaggttggagcccctgctctggacaagtttaacatgtgggggggctcgctgtcgctgggacacccgtttggagccacaggttgccggctggtcatggctgctgcccacaggctgaagaaggacggagggcaatacggccttgtggcagcgtgtgcggcaggggggcagggacacgggatgatcgtggaactttacccccagtaacgtgacacaaacccatcggactcgttatggctgacgccagtttcctgcactaattaactgagaaggtcccctccccgtcgccaagaatgtcgcagcactgtaaatattttctagttgccttgtctgtgattggaatgagtaattggttttccagagcacttggtacgtcccagtttggaacgacccattgtgcaagcttagtgctgagctctccagctcctgggctgctcgtctgtttcgatttggcagagctgaatcctgttagactttgtgtttaatagactgtaaagcacttacacccaatgtacagtcagtggtagaatcagctgcagccactttaccaacgggggcgttgctaccggcccttctgccttaataaacaagatcttcactaaaaaaaaacaaaaaaaaaaaaaaaa
Translation: MACMLRQTIRSLPTACKLSSRSISCSSHLQAPAVQAKTKKTLAKPGVKNVVIVDGVRTPFLLSGTTYADLMPHDLARTALQGLLQRTNVPREVVDYIVYGTVIQEVKTSNVAREAALGAGFSDKTPAHTVTMACISSNQAMTTGVGLIASGQCDVVVAGGVEFMSDVPIRHSRKMRKTMLSLNKAKTLGQRLSVISGIRPNYFAPELPAVAEFSTSETMGHSADRLAAAFSVSRVEQDEYALRSHTLAKKAQDAGLLSDVIPYKVPGKQTVDKDNGIRPSSMEQMAKLKPAFIKPHGSVTAANSSFLTDGASAVLIMSEEKALAMGYKPKAYLRDFVYVSQDPKDQLLLGPTYATPKVLERAGLTLADIDAFEFHEAFAGQILSNLKAMDSDWFAQNYMGRKAKVGAPALDKFNMWGGSLSLGHPFGATGCRLVMAAAHRLKKDGGQYGLVAACAAGGQGHGMIVELYPQ
Donor tissue: neurula