ORFeome > MGC75834 – XORFeome 2.0

MGC75834 – XORFeome 2.0

General Information

Species: Xenopus tropicalis hypothetical protein MGC75834, mRNA (cDNA clone MGC:75834 IMAGE:5382516), complete cds
Gene Symbol: MGC75834
Gene ID: 394654
ORF gb_acc: MG133027
ORF ID: 10417

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC061328

Library Location

Plate ID: GDExt11004
Well Location: F05

EST Sequences

Clone: MGC:75834 IMAGE:5382516
Trimmed Sequence: ATGCTGTGCGAGCAGATAAAAGAGTATGTGGACGTCAGCCGGGAGATCGTCAAAGTTATGGTGTCGGACTCGGCAGCTGTAGCCTTAAAGAAAAGCTTGGACCGGCAGGAGGCCATGATAGATTTGCTCTTGGATACGGAAACAGAAGCTTCGCAACTCATCCGAGATTTCATGGCTGTGGAAGAGAAAGTGGCACAAACACTTCTGGACACTGAAGAAACAAAACAGAAAACATCATCCAAGCTGCAGAAAATAGAGCGAGAACTGCAGGAGAAAATTGAAAAGAATTCATCGCTGGAATCAGGCATAAAATTCCTACAGAAAGAGCTGGAAGAACTGAAGATGATGGAGGAAGAGATTGCTGACATGGAGAGAGAGGCAGATGAAGATACCACAACAGTCATTCCCTCGGCAGTGTATTTGGCGAAACTGTTCCACAATGTGACGAAAATTGATTGGGATTATAACTGTGATCCCTCCCTTATCAAAGGCATTCACTATGGAGGAGAGATCGCTCAGCCTATCAGCATTGACAGCAACCAGCACTCGAAAATCTTCATTTGTAACTACCTGTGGAGCCTTTTGTCCACAGACTGGTAA
Full Trace Sequence: ggaagttgtcaaatgcattggcgactctcggcgggacttttgaatagaactcggggggcagcgggcctgttactgggcgcactttgggccaaagtattatcgcacctattagatttgctttccctctgacctgtgaggagccatgctgtgcgagcagataaaagagtatgtggacgtcagccgggagatcgtcaaagttatggtgtcggactcggcagctgtagccttaaagaaaagcttggaccggcaggaggccatgatagatttgctcttggatacggaaacagaagcttcgcaactcatccgagatttcatggctgtggaagagaaagtggcacaaacacttctggacactgaagaaacaaaacagaaaacatcatccaagctgcagaaaatagagcgagaactgcaggagaaaattgaaaagaattcatcgctggaatcaggcataaaattcctacagaaagagctggaagaactgaagatgatggaggaagagattgctgacatggagagagaggcagatgaagataccacaacagtcattccctcggcagtgtatttggcgaaactgttccacaatgtgacgaaaattgattgggattataactgtgatccctcccttatcaaaggcattcactatggaggagagatcgctcagcctatcagcattgacagcaaccagcactcgaaaatcttcatttgtaactacctgtggagccttttgtccacagactggtaattcccaccgtcggataacgaacttcttgcagaggtagtagcgatctgactattccgtggtctgggcaacatccctgcatggccacttgccctttaaccagttggactgtatgaagctggagtttctgcacccctgattgctggcacttacactagaatctgagaaatcccaagtaagcgctgactttctttggtgcttttaaggcaaagttaatattcatttttataggttaagtttacattcatgttttttcttttttttaaaaaaaattattaatattaaaagtgcttgcaaagcaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MLCEQIKEYVDVSREIVKVMVSDSAAVALKKSLDRQEAMIDLLLDTETEASQLIRDFMAVEEKVAQTLLDTEETKQKTSSKLQKIERELQEKIEKNSSLESGIKFLQKELEELKMMEEEIADMEREADEDTTTVIPSAVYLAKLFHNVTKIDWDYNCDPSLIKGIHYGGEIAQPISIDSNQHSKIFICNYLWSLLSTDW
Donor tissue: neurula