ORFeome > MGC75920 – XORFeome 2.0

MGC75920 – XORFeome 2.0

General Information

Species: Xenopus tropicalis hypothetical protein MGC75920, mRNA (cDNA clone MGC:75920 IMAGE:5383714), complete cds
Gene Symbol: MGC75920
Gene ID: 394641
ORF gb_acc: MG132994
ORF ID: 10377

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC061364

Library Location

Plate ID: GDExt11004
Well Location: E11

EST Sequences

Clone: MGC:75920 IMAGE:5383714
Trimmed Sequence: ATGGTCATAGGGGCGGCGGTGGCGGCTTTGGGTTCGGTTCTGTTCATTGCATGGAGCCGTTACTTCCCAGTCCAGAGGAGAAGGAGGCGGTGCCTGGCGTGCAGCCCAGCCACAGAGCAGGTTAAATATCTGGATAGGCAGATATTAGTACTGGGTTTGGATGGAGCTGGCAAAAGCAGCATTATTCATGCCATTAGCACCAATACCACTAGGTCCAGTTCTGCACCAACTCATGGATTTAATTCTGCCCAGATTATCCACCAAGGACTGCGGATTGAATTACTGGAAGTTGGAGGCAGCCAGAATCTTCGCACATACTGGAGCCAATATCTGAAGAATGCCAATGTTATAGTCTTTGTAGTGGACTCAACAGACAACAAGCGCCTCCACCTTGCTAGGCAAGAACTGCACCGGCTTCTTCATGAAGCGCCAGATCTTCCCCTTATGGTTCTGGCAAATAAGCAGGATCAGAATACTGCACTTTGCCTTCCTGAAATTCACTCAGAACTGTCACTGCACCGGATTACTGGCGAAAGAGAGGTAACCTTGCTGGGAACTAGTGCTGTATCAGATGGAGCTGGCCACAGCACCAGACTACAGACTGTGAAGACATTGTTAGAGGAAAGACTACATAGACCGAAAGGGCCAGCACAGAATGGTGCCAATCATCCACAAGCCACCCAGTGCCACACATCTCTTCAAAATGATGGTTAA
Full Trace Sequence: gtgagtttctccgctcctgttcattgttgttattttattatttacatgtgattttcatctttggggcggcgcgatcaagtgagtgacatcacggccggcgatgccaacagatggctgctctgaggagcctcaccatggtcataggggcggcggtggcggctttgggttcggttctgttcattgcatggagccgttacttcccagtccagaggagaaggaggcggtgcctggcgtgcagcccagccacagagcaggttaaatatctggataggcagatattagtactgggtttggatggagctggcaaaagcagcattattcatgccattagcaccaataccactaggtccagttctgcaccaactcatggatttaattctgcccagattatccaccaaggactgcggattgaattactggaagttggaggcagccagaatcttcgcacatactggagccaatatctgaagaatgccaatgttatagtctttgtagtggactcaacagacaacaagcgcctccaccttgctaggcaagaactgcaccggcttcttcatgaagcgccagatcttccccttatggttctggcaaataagcaggatcagaatactgcactttgccttcctgaaattcactcagaactgtcactgcaccggattactggcgaaagagaggtaaccttgctgggaactagtgctgtatcagatggagctggccacagcaccagactacagactgtgaagacattgttagaggaaagactacatagaccgaaagggccagcacagaatggtgccaatcatccacaagccacccagtgccacacatctcttcaaaatgatggttaatatgtgtgccacagacatctacaaatgtttacagtgaccgttaccatcctcttactgctccaggttttcgggcaatctattccttttgcaggcgcagacaaatacaactgtgagaagatggtctgacagactatatgccaaaagctggacacttgttagtgacacagtttacacttagtgtgtgctggcccacacactgcttcagggttctaataaaaataaatcactgctgttcataaataagctataaatgatgagggagagaaaatttgtaaaattatatataattatatataataaaatgactaagttggtgctaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MVIGAAVAALGSVLFIAWSRYFPVQRRRRRCLACSPATEQVKYLDRQILVLGLDGAGKSSIIHAISTNTTRSSSAPTHGFNSAQIIHQGLRIELLEVGGSQNLRTYWSQYLKNANVIVFVVDSTDNKRLHLARQELHRLLHEAPDLPLMVLANKQDQNTALCLPEIHSELSLHRITGEREVTLLGTSAVSDGAGHSTRLQTVKTLLEERLHRPKGPAQNGANHPQATQCHTSLQNDG
Donor tissue: neurula