ORFeome > MGC75941 – XORFeome 2.0

MGC75941 – XORFeome 2.0

General Information

Species: Xenopus tropicalis purinergic receptor P2Y, G-protein coupled, 2, mRNA (cDNA clone MGC:75941 IMAGE:5383884), complete cds
Gene Symbol: MGC75941
Gene ID: 394636
ORF gb_acc: MG133000
ORF ID: 10386

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC061378

Library Location

Plate ID: GDExt11004
Well Location: C09

EST Sequences

Clone: MGC:75941 IMAGE:5383884
Trimmed Sequence: ATGAACGCGTCTGGAGGCGGAGAGAACTCCACGTACAAGTGTAAATTCGACGAGGATTTCAAGTACGTCCTCCTCCCCGTGTCGTACGGCATCGTGTTCTGCGTGGGGCTGATCCTGAACATTCTGGCCCTGTACATCTTCCTGTTCCGGATCAAGCCCTGGAACGCCTCCACCACCTACATGTTCAACCTGGCCATTTCCGACATGATGTACGTCATCTCCCTCCCGCTGCTGGTCTATTACTACTCGCAGGGGGACAACTGGCCGTTCGGCGTGGCCTTGTGCAAGATCGTCAAGTTCCTTTTCTACACCAACATGTACTGTAGCATCTCCTTCTTGCTGTGCATCAGCATCCACCGCTTCCTCGGGATCTGCTACCCAATGAAATCACTCGGTTGGCTGAAGGTGCGGAATGCTCGGATTATTTCCGTGGTCGTCTGGGTTATCGTTTCCGCCTGTCAGTCCCCTATATTGTACTTTGTTACCACCAGTTCCAATGGGGACAGCACCACCTGCCATGACACTTCCAGCGTGGATCTATTTGACAACTTTGTGGTCTACAGCACAGTCGACTTGGCCTTGCTTTTCTGCGTCCCGTTCATCACCATTATTATCTGCTATTGCTTGATGGCACGGACCCTTATGAAGCCCTCAGCCGCCACCGCTCAGACTTCGGCTTCCAAGAAGAAATCGATTAAAATGATTATCATTGTCTTGGCGGTCTTCATCATTTGTTTCTTGCCTTTTCATATCAATCGGACCCTTTATTACTATTTCCGCAAGATGGAACTTGACTGTGACATATTGAACGCCATTAACTTGGCCTATAAAGTGACCAGACCCTTGGCCAGTGCCAACAGCTGCCTTGACCCCATATTGTACTTTCTGGCCGGACAGACTGTTAGGAGAAGCATCATTCCCAGAAACGGACTCTCAAAAATGAAGAACAAATTTACATCCTATGTTCTAGAGAACAACTGGAGCGGCAGTGCCACCGGTGTCTCCAACAGTGAGGCCAGGCAGAGCCCGGCTGTAATTAGCAAAGTGTAA
Full Trace Sequence: caacgaggagggcactggccaggacttagcttctccttgtggggttaagactacgaaagcagaaaaatgaacgcgtctggaggcggagagaactccacgtacaagtgtaaattcgacgaggatttcaagtacgtcctcctccccgtgtcgtacggcatcgtgttctgcgtggggctgatcctgaacattctggccctgtacatcttcctgttccggatcaagccctggaacgcctccaccacctacatgttcaacctggccatttccgacatgatgtacgtcatctccctcccgctgctggtctattactactcgcagggggacaactggccgttcggcgtggccttgtgcaagatcgtcaagttccttttctacaccaacatgtactgtagcatctccttcttgctgtgcatcagcatccaccgcttcctcgggatctgctacccaatgaaatcactcggttggctgaaggtgcggaatgctcggattatttccgtggtcgtctgggttatcgtttccgcctgtcagtcccctatattgtactttgttaccaccagttccaatggggacagcaccacctgccatgacacttccagcgtggatctatttgacaactttgtggtctacagcacagtcgacttggccttgcttttctgcgtcccgttcatcaccattattatctgctattgcttgatggcacggacccttatgaagccctcagccgccaccgctcagacttcggcttccaagaagaaatcgattaaaatgattatcattgtcttggcggtcttcatcatttgtttcttgccttttcatatcaatcggaccctttattactatttccgcaagatggaacttgactgtgacatattgaacgccattaacttggcctataaagtgaccagacccttggccagtgccaacagctgccttgaccccatattgtactttctggccggacagactgttaggagaagcatcattcccagaaacggactctcaaaaatgaagaacaaatttacatcctatgttctagagaacaactggagcggcagtgccaccggtgtctccaacagtgaggccaggcagagcccggctgtaattagcaaagtgtaattaaccgagaaatgagccaaacagacacgagacatcggtgtagagggaacctcgctgtaggttctacatataccagatgcttcatgctacattagttttggggtatcaacctccgtgaggtaaaatagctacacgtagaaatcaatatgaagaaatatggtgcctttatctatgtggcaaatataatgtaacattcccagatattttatatattaccttttactttatatttaagaaagtctaggacagacaaggggcttccctaagctagaagcattactaggccccctgagcatgaagtagggattggcaggtaacaaatgaaattgaccccagtggtgacaaaagcctgggataaacacggatgctccatccagatttattttgtttcgctattgcagccatttcaactgcagctcttttagttacttccttgtctagtgtgaagtcagtaaaagagctgcagttcagctccttgtaatagagaaacaaagtaaatctgcatgcaggaagaaaggtatgttattccggggactgtacagagtcattttaggagcgtttaaaataaaaaggcttatttatctcatatgggataataacgtgatggacgtatgtcttttttcaacccaacttactaacttactatgtatgttactaagccccctgagcatgaagtagggattggcaggtaaccaatgaaattgaccccagtggtgacaaaagcctgggataaacacagatgctccatccagatttattttgtttcgctattgcagccatttcaactgcagctcttttagttacttccttgtctagtgtgaagtcagtaaaagagctgcagttcagctgcttgtaatagagaaacaaagtaaatctgcatgcagggagaaaggtatgttattcctggggctgtacagagtcattttaggagcgtttaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MNASGGGENSTYKCKFDEDFKYVLLPVSYGIVFCVGLILNILALYIFLFRIKPWNASTTYMFNLAISDMMYVISLPLLVYYYSQGDNWPFGVALCKIVKFLFYTNMYCSISFLLCISIHRFLGICYPMKSLGWLKVRNARIISVVVWVIVSACQSPILYFVTTSSNGDSTTCHDTSSVDLFDNFVVYSTVDLALLFCVPFITIIICYCLMARTLMKPSAATAQTSASKKKSIKMIIIVLAVFIICFLPFHINRTLYYYFRKMELDCDILNAINLAYKVTRPLASANSCLDPILYFLAGQTVRRSIIPRNGLSKMKNKFTSYVLENNWSGSATGVSNSEARQSPAVISKV
Donor tissue: neurula